Clik here to view.
Bitter Apricot Seed ( Xingren ) 杏仁
Xing Ren is the mature seed of Prunus armeniaca L. var. ansu Maxim, P. armeniaca L., P. mandshurica (Maxim.) Koehne or P. sibirica L., family Rosaceae. Main ingredients Xing Ren contains 50% of...
View ArticleClik here to view.
SITAFLOXACIN …………Antibacterial [DNA-gyrase inhibitor]
7-[(4S)-4-Amino-6-azaspiro[2.4]heptan-6-yl]-8-chloro-6-fluoro-1-[(2S)-2-fluorocyclopropyl]-4-oxoquinoline-3-carboxylic acid...
View ArticleClik here to view.
Plazomicin…………against multidrug-resistant Klebsiella pneumoniae and...
Plazomicin 6′-(hydroxylethyl)-1-(haba)-sisomicin Plazomicin is a neoglycoside antibiotic with activity against a broad range of Gram-positive and Gram-negive pathogens. Plazomicin showed potent in...
View ArticleClik here to view.
A safe, cheap and effective method for slow-freezing human stem cells
Originally posted on lyranara.me: Human pluripotent stem cells (hPSCs) show great potential and versatility in regenerative medicine and new therapeutic approaches to fight disease. Patient-specific,...
View ArticleClik here to view.
LCB01-0371……..new oxazolidinone has improved activity against Gram-positive...
LCB01-0371 LegoChem Biosciences (South Korea) Phase I, Gram-positive LCB01-0371 is being developed by LegoChem Bio. This new oxazolidinone has improved activity against Gram-positive pathogens and...
View ArticleClik here to view.
BC-3781……A Pleuromutilin by Nabriva (Austria) in phase 2
BC-3781 Topical pleuromutilin antibiotic agent Gram-positive, including MRSA, PHASE 2 COMPLETED Nabriva (Austria) BC-3781 The pleuromutilin BC-3781 belongs to the first generation of pleuromutilins...
View ArticleClik here to view.
Radezolid in phase 2,Rib-X Pharmaceuticals
Radezolid 869884-78-6 cas no http://www.ama-assn.org/resources/doc/usan/radezolid.pdf 869884-78-6, RX-103, RX-1741, RX-O1_667, Radezolid (USAN/INN), UNII-53PC6LO35W Molecular Formula: C22H23FN6O3...
View ArticleClik here to view.
Posizolid
POSIZOLID 252260-02-9 CAS NO (5R)-3-[4-[1-[(2S)-2,3-Dihydroxypropanoyl]-3,6-dihydro-2H-pyridin-4-yl]-3,5-difluorophenyl]-5-(1,2-oxazol-3-yloxymethyl)-1,3-oxazolidin-2-one AstraZeneca (Originator)...
View ArticleClik here to view.
Moringa Oleifera Kills 97% of Pancreatic Cancer Cells in Vitro
Moringa Oleifera Kills 97% of Pancreatic Cancer Cells in Vitro: A hot-water extract of moringa leaves was shown to kill up to 97% of human pancreatic cancer cells (Panc-1) after 72 hours in this...
View ArticleClik here to view.
MicuRx Pharmaceuticals (USA) has MRX I IN PHASE 1 for resistant Gram-positive...
MRX I MRX-I 1112968-42-9 cas no C18 H15 F3 N4 O4 4(1H)-Pyridinone, 2,3-dihydro-1-[2,3,6-trifluoro-4-[(5S)-5-[(3-isoxazolylamino)methyl]-2-oxo-3-oxazolidinyl]phenyl]- IN...
View ArticleClik here to view.
Tuberculosis: the drug development pipeline at a glance.
Tuberculosis: The drug development pipeline at a glance Review Article Pages 1-16 Baptiste Villemagne, Céline Crauste, Marion Flipo, Alain R. Baulard, Benoit Déprez, Nicolas Willand Graphical...
View ArticleClik here to view.
EPEREZOLID
EPEREZOLID pfizer.originator CAS NO 165800-04-4 Eperezolid [USAN], PNU 100592, U-100592, Molecular Formula: C18H23FN4O5 Molecular Weight: 394.397423...
View ArticleClik here to view.
SUTEZOLID for Treatment of tuberculosis
Sutezolid 168828-58-8 N-({(5S)-3-[3-fluoro-4-(thiomorpholin-4-yl)phenyl]-2-oxo-oxazolidin-5-yl}methyl) acetamide (S)—N-[[3-[3-fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide...
View ArticleClik here to view.
Gold Nanoparticles Made to Heat Up from Near-Infrared Light for Tumor Killing
Originally posted on lyranara.me: Gold has been a popular material to make nanoparticles because of its biocompatibility, but to get it to do some neat tricks isn’t enough to simply produce spherical...
View ArticleClik here to view.
Ranbezolid from Ranbaxy as an oxazolidinone antibacterial
Ranbezolid 392659-39-1 hydrochloride 392659-38-0 (free base) N-{[(5S)-3-(3-Fluoro-4-{4-[(5-nitro-2-furyl)methyl]-1-piperazinyl}phenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide...
View ArticleClik here to view.
BC-7013 a Topical pleuromutilin antibiotic agent from Nabriva
BC-7013 (topical) [14-O-[(3-Hydroxymethyl-phenylsulfanyl)-acetyl]-mutilin] Pleuromutilins Nabriva Gram-positive poster……….https://jmilabs.com/data/posters/ICAAC2009/F1-1521.pdf BC-7013...
View ArticleClik here to view.
Valnemulin
Valnemulin 101312-92-9, (3aS,4R,5S,6S,8R,9R,9aR,10R)-6-ethenyl- 5-hydroxy-4,6,9,10-tetramethyl-1-oxodecahydro- 3a,9-propano-3aH-cyclopenta[8]annulen-8-yl-...
View ArticleClik here to view.
MK 2048 an HIV integrase inhibitor from Merck
MK 2048 Molecular Formula: C21H21ClFN5O4 Molecular Weight: 461.873943 869901-69-9, 3oyl, 3oyn Merck & Co., Inc....
View ArticleClik here to view.
ATL1102 for MS – Toxicology Study Main Findings
Sequence Type: DNA fragment CTGAGTCTGTTTTCCATTCT ATL 1102 The antisense oligonucleotide is complementary to a region in the 3′UTR of human ITGA4 (integrin alpha 4) cDNA whose sequence is...
View ArticleClik here to view.
MG 96077 in Pre-Clinical for Gram-negative bacteria
MG 96077 poster MG96077 - MethylGene ………..http://methylgene.solocom.biz/files/2011/10/poster102.pdf ……………..lot of data presented Mirati Therapeutics (USA) Pre-Clinical for Gram-negative bacteria...
View Article