Xing Ren is the mature seed of Prunus armeniaca L. var. ansu Maxim, P. armeniaca L., P. mandshurica (Maxim.) Koehne or P. sibirica L., family Rosaceae.

Main ingredients
Xing Ren contains 50% of fatty oils (including oleic, linoleic. palmitic, stearic and linolenic acids), as well as amygdalin, amygdalase and prunase. Hydrolysing amygdalin generates benzaldehyde and hydrocyanic acid, which is toxic

Bitter Apricot Seed ( Xingren ) 杏仁

Bitter Apricot Seed ( Xingren ) 杏仁 , also known as xing ren 杏仁，ku xing ren 苦杏仁，kuang xing ren 光杏仁，ku he ren 杏核仁，炒杏仁，jian xing ren 尖杏仁，xing ren xiang 杏仁霜. It belong to the “Rosaceae” family.

Bitter Apricot Seed ( Xingren ) 杏仁 has a warm, bitter and slightly toxic. It is use for treating the lung and large intestine.

Pharmaceutical Name: Semen Armeniacae.Botanical Name: 1. Prunus armeniaca L. var. ansu maxim.; 2. Prunus mandshurica(Maxim.) Koehne; 3. Prunus sibirica L.

Common Name: Apricot seed, Bitter apricot seed or kernel.Source of Earliest Record: Shennong Bencao Jing.Part Used & Method for Pharmaceutical

Preparations: The seeds are collected after the apricot ripens in summer. They are then dried in the sun and pounded into pieces.Properties & Taste: Bitter, slightly warm and slightly toxic.Meridians: Lung and large intestine.

Functions: 1. To stop cough and relieve asthma; 2. To moisten the intestines and move stool.Indications & Combinations:1. Cough and asthma: a) cough due to invasion by exogenous pathogenic wind and heat Apricot seed (Xingren) is used with Mulberry leaf (Sangye) and Chrysanthemum flower (Juhua) in the formula Sang Ju Yin; b) cough due to dysfunction of the lungs caused by dryness and heatApricot seed (Xingren) is used with Mulberry leaf (Sangye), Tendrilled fritillary bulb (Chuanbeimu) and Glehnia root (Shashen) in the formula Sang Xing Tang; c) cough and asthma due to accumulated heat in the lungsApricot seed (Xingren) is used with Gypsum (Shigao) and Ephedra (Mahuang) in the formula Ma Xing Shi Gan Tang.2. Constipation due to dryness in the intestines: Apricot seed (Xingren) is used with Hemp seed (Huomaren) and Chinese angelica root (Danggui) in the formula Runchang Wan.Dosage: 3-10 g.Cautions & Contraindications: This herb is slightly toxic, so overdosing should be avoided. It should be used with caution in infants.

Bitter Apricot Seed ( Xingren ) 杏仁

1. Arresting coughing and asthma.
2. Expelling phlegm.
3. Help bowel movements.

Bitter Apricot Seed ( Xingren ) 杏仁 Toxicity & Cautions:

Bitter Apricot Seed ( Xingren ) 杏仁 contain hydrogen cyanide which is a strong toxin. Eating 20 to 30 piece may cause toxic reaction even death. The toxin can be hydrolyzed in cooking and can render it non toxic. It is not recommended for small children.

Properties
Taste: bitter; nature: slightly warm; slightly toxic.

Channels entered
Lung and Large Intestine.

Functions and indications
Stops coughing and calms wheezing, moistens the Intestines and frees the bowels. It is indicated for coughing and wheezing, sore throat andconstipation.

Common dosage
3-10g, decocted for a short time only.

Precautions and contraindications

1. As Xing Ren is slightly toxic, large dosages should be avoided, especially when treating infants.
2. Contraindicated in cases of weak constitution and profuse sweating.

Remarks
Ku Xing Ren (Semen Pruni Armeniacae Amarum), or bitter apricot kernel, is normally used for this herb.

In China, people who can afford to buy apricot as a fresh fruit generally throw the stones away. Servants and the less fortunate children gatherthe stones and sell them to collectors who use cheap labor to crack the shells (endocarp) and free the seeds (kernel) with the brown seed coat tightly covering the embryo (two cotyledons with the small radical and plumule).

In Chinese prescriptions, an apricot seed with the brown seed coat intact is called bei-xing-ren (northern apricot seed). All Chinese apothecaries keep a supply of apricot seeds in this state.

Detoxificated apricot seed: The major portion of the annual production of apricot seed is detoxified, processed by being first subjected to boiling water to loosen the seed coat, which can then be rubbed off by hand, followed by soaking the white cotyledons in cold water with several changes to eliminate the bitter element and to detoxify them. Then the detoxified white cotyledons are dried for the market. In Chinese prescriptions, this decoated and detoxified material is called nan-xing-ren (southern apricot seed) or tian-xing-ren (sweet apricot seed), which is also available in apothecaries. However, a greater portion of the detoxified material is used in pastry and for food.

Toxicity
The LD for intravenous injection of amygdalin in mice or rats is 25g/kg; for intraperitoneal injection, it is 8g/kg; and for oraladministration, it is O.6g/kg. Oral administration of 55 pieces (the equivalem of about 60g) of Ku Xing Ren, containing 1.8g of amygdalin, can cause death in humans. The main symptoms oftoxic reaction include a bitter taste in the mouth, dizziness, nausea, vomiting, pain in the abdomen, diarrhoea, agitation, vexation and restlessness, palpitations, and weakness of the limbs, and in severe cases, oppression in the chest, difficulty in breathing, loss of consciousness, a reduction in blood pressure and even coma. Ku Xing Ren should therefore not be used raw and overdosage must be avoided.

Modern Research

1. Inhibits the respiratory centre to stop coughing and calmwheezing.
2. Affects digestion by inhibiting the activity of pepsins.
3. Reduces the level of blood fats.
4. Inhibits inflammation and alleviates pain.
5. Inhibits carcinoma

7-[(4S)-4-Amino-6-azaspiro[2.4]heptan-6-yl]-8-chloro-6-fluoro-1-[(2S)-2-fluorocyclopropyl]-4-oxoquinoline-3-carboxylic acid

(1R-(1a(S*),2a))-7-(7-Amino-5-azaspiro[2.4]hept-5-yl)-8-chloro-6-fluoro-1-(2-fluorocyclopropyl)-1,4-dihydro-4-oxo-3-quinolinecarboxylic Acid

SYNTHESIS……….http://www.drugfuture.com/synth/syndata.aspx?ID=176447

127254-10-8 [RN]

127254-10-8(ACETATE)

Sitafloxacin (INN; also called DU-6859a) is a fluoroquinolone antibiotic^[1] that shows promise in the treatment of Buruli ulcer. The molecule was identified by Daiichi Sankyo Co., which brought ofloxacin and levofloxacin to the market. Sitafloxacin is currently marketed in Japan by Daiichi Sankyo under the tradename Gracevit.

Sitafloxacin is a new-generation, broad-spectrum oral fluoroquinolone antibiotic.It is very active against many Gram-positive, Gram-negative and anaerobic clinical isolates, including strains resistant to other fluoroquinolones, was recently approved in Japan for the treatment of respiratory and urinary tract infections. Sitafloxacin is active against methicillin-resistant staphylococci, Streptococcus pneumoniae and other streptococci with reduced susceptibility to levofloxacin and other quinolones and enterococci

163253-35-8

AU 8933702; EP 0341493; JP 1990231475; JP 1995300416; JP 1999124367; JP 1999124380; US 5587386; US 5767127
The condensation of 3-chloro-2,4,5-trifluorobenzoylacetic acid ethyl ester (I) with (1R,2S)-N-(tert-butoxycarbonyl)-2-fluorocyclopropylamine (III) and ethyl orthoformate (II) in hot acetic anhydride gives (1R,2S)-2-(3-chloro-2,4,5-trifluorobenzoyl)-3-(2-fluorocyclopropylamino)acrylic acid ethyl ester (IV). The cyclization of (IV) by means of NaH yields the quinolone (V), which is hydrolyzed with HCl to the free acid (VI). The condensation of (VI) with 7(S)-(tert-butoxycarbonylamino)-5-azaspiro[2.4]heptane (VII) by means of triethylamine in refluxing acetonitrile affords the protected final product (VIII), which is finally deprotected with trifluoroacetic acid and anisole.

The chiral intermediate (1R,2S)-N-(tert-butoxycarbonyl)-2-fluorocyclopropylamine (III) is obtained as follows: 1) The cyclization of butadiene (IX) with dibromofluoromethane by means of BuONa, followed by oxidation with KMnO4, esterification with ethanol – sulfuric acid and reduction with tributyltin hydride gives 2-fluorocyclopropanecarboxylic acid ethyl ester as a cis/trans mixture (X), which is separated by crystallization. The cis-racemic-isomer (XI) is hydrolyzed with NaOH to the corresponding acid (XII), which is condensed with (R)-alpha-methylbenzylamine (XIII) by means of diphenyl chlorophosphate to give the mixture of diastereomers (XIV). This mixture is separated by crystallization, yielding pure (1S,2S)-2-fluoro-N-[alpha(R)-methylbenzyl]cyclopropanecarboxamide (XV), which is hydrolyzed with HCl to the corresponding free acid (XVI). Finally, this compound is converted into (III) by treatment with diphenylphosphoryl azide in refluxing tert-butanol.

b) The intermediate 7(S)-(tert-Butoxycarbonylamino)-5-azaspiro[2.4]heptane (VII) can also be obtained as follows: 1) The cyclopropanation of ethyl acetoacetate (XXXI) with 1,2-dibromoethane (XXXII) by means of K2CO3 in DMF gives 1-acetylcyclopropane-1-carboxylic acid ethyl ester (XXXIII), which is brominated with Br2 in ethanol yielding the bromoacetyl derivative (XXXIV). The cyclization of (XXXI) with (R)-alpha-methylbenzylamine (XIII) by means of triethylamine affords 5-[1(R)-phenylethyl]-5-azaspiro[2.4]heptane-4,7-dione (XXXV), which by reaction with hydroxylamine is converted into the monooxime (XXXVI). The reduction of (XXXVI) with H2 over RaNi in methanol affords 7-amino-5-[1(R)-phenylethyl]-5-azaspiro[2.4]heptan-4-one as a diastereomeric mixture (XXXVII) + (XXXVIII), which is separated by column chromatography. The reduction of the (7S)-isomer (XXXVIII) with LiAlH4 in THF gives 7(S)-amino-5-[1(R)-phenylethyl]-5-azaspiro[2.4]heptane (XXXIX), which is protected in the usual way to the tert-butoxycarbonyl derivative (XL). Finally, this compound is debenzylated to (VII) by hydrogenation with H2 over Pd/C in ethanol.

The chiral intermediate (1R,2S)-N-(tert-butoxycarbonyl)-2-fluorocyclopropylamine (III) is obtained as follows: 1) The cyclization of butadiene (IX) with dibromofluoromethane by means of BuONa, followed by oxidation with KMnO4, esterification with ethanol – sulfuric acid and reduction with tributyltin hydride gives 2-fluorocyclopropanecarboxylic acid ethyl ester as a cis/trans mixture (X), which is separated by crystallization. The cis-racemic-isomer (XI) is hydrolyzed with NaOH to the corresponding acid (XII), which is condensed with (R)-alpha-methylbenzylamine (XIII) by means of diphenyl chlorophosphate to give the mixture of diastereomers (XIV). This mixture is separated by crystallization, yielding pure (1S,2S)-2-fluoro-N-[alpha(R)-methylbenzyl]cyclopropanecarboxamide (XV), which is hydrolyzed with HCl to the corresponding free acid (XVI). Finally, this compound is converted into (III) by treatment with diphenylphosphoryl azide in refluxing tert-butanol.

b) The intermediate 7(S)-(tert-Butoxycarbonylamino)-5-azaspiro[2.4]heptane (VII) can also be obtained as follows: 2) The reaction of 1-acetylcyclopropane-1-carboxylic acid ethyl ester (XXXIII) with (R)-alpha-methylbenzylamine (XIII) by means of NaOH and ethyl chloroformate gives the corresponding amide (XLI), which by reaction with ethylene glycol and p-toluenesulfonic acid is converted into the ethylene ketal (XLII). The bromination of (XLII) with Br2 in dioxane affords the bromomethyl dioxolane (XLIII), which is finally cyclized to 5-[1(R)-phenylethyl]-5-azaspiro[2.4]heptane-4,7-dione (XXXV), already obtained as an intermediate in the preceding synthesis.

The chiral intermediate (1R,2S)-N-(tert-butoxycarbonyl)-2-fluorocyclopropylamine (III) can also be obtained as follows: 3) A study of the influence of different substituents in the cis/trans ratio of the cyclopropanation process has been performed. The general method is as follows: the reaction of benzylamine (XXIII) with acetaldehyde and trichloromethyl chloroformate gives the N-benzyl-N-vinylcarbamoyl chloride (XXIV), which by treatment with alcohol yields the N-vinylcarbamate (XXV). The cyclopropanation of (XXV) with fluorodiiodomethane and diethyl zinc as before preferentially affords the cis-N-(2-fluorocyclopropyl)carbamate (XXVI), which is purified by crystallization. The hydrogenolysis of (XXVI) with H2 over Pd/C in acetic acid gives cis-racemic-2-fluorocyclopropylamine (XXVII), which is submitted to optical resolution with L-menthyl chloroformate to afford pure (1R,2S)-isomer (XXII). Finally, this compound is converted into (III) with tert-butoxycarbonyl anhydride as before.

References

• Keating GM (April 2011). “Sitafloxacin: in bacterial infections”. Drugs 71 (6): 731–44. doi:10.2165/11207380-000000000-00000.PMID 21504249.

• (Japanese) Gracevit グレースビット (PDF) Daiichi Sankyo Co. January 2008.

Plazomicin

6′-(hydroxylethyl)-1-(haba)-sisomicin

Plazomicin is a neoglycoside antibiotic with activity against a broad range of Gram-positive and Gram-negive pathogens. Plazomicin showed potent in vitro activity against multidrug-resistant Klebsiella pneumoniae and Escherichia coli.

To continue the development of plazomicin, the company has received a contract option of US$ 60M from the Biomedical Advanced Research and Development Authority (BARDA) to support a global Phase III clinical study. The study will evaluate plazomicin in treating patients with serious Gram-negative bacterial infections due to carbapenem-resistant Enterobacteriaceae. The study is expected to start in the fourth quarter of 2013 [4].

Achaogen (a-KAY-o-jen) is developing plazomicin, its lead product candidate, for the treatment of serious bacterial infections due to MDR Enterobacteriaceae, including carbapenem-resistant Enterobacteriaceae, or CRE. In 2013, the Centers for Disease Control and Prevention identified CRE as a “nightmare bacteria” and an immediate public health threat that requires “urgent and aggressive action.” We expect to initiate a Phase 3 superiority trial of plazomicin in the first quarter of 2014.

CRE are one of many types of MDR gram-negative pathogens threatening patients. Bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii, and extended-spectrum beta-lactamase producing Enterobacteriaceae each pose “serious” resistance threats, according to the CDC, and also drive a great need for new, safe, and effective antibiotics. We have assembled the chemistry and microbiology expertise and capabilities required to develop new agents for the treatment of gram-negative infections. Plazomicin was the first clinical candidate from our gram-negative antibiotic discovery engine. In addition, our research and development pipeline includes two antipseudomonal programs targeting P. aeruginosa—a program to discover and develop small molecule inhibitors of LpxC, which is an enzyme essential for the synthesis of the outer membrane of gram-negative bacteria, and a therapeutic antibody program. We are also pursuing small molecule research programs targeting other essential gram-negative enzymes.

Achaogen has built an exceptional research and development team with deep expertise in the discovery and development of new drugs from research through commercialization. Our executive team has over 60 years of combined industry experience, and a proven track record of leadership, global registration, and lifecycle management for over 20 products. Our facility is located on the shores of the San Francisco Bay, ten minutes from the San Francisco International Airport, and only fifteen minutes from downtown San Francisco.

http://www.google.com/patents/US20100099661

Common Intermediates Sisomicin

 

 

Amberlite IRA-400 (OH form) (200 g) was washed with MeOH (3×200 m1). To a stirring suspension of the washed resin in MeOH (150 mL) was added sisomicin sulfate (20.0 g, 0.029 mol) and the mixture was stirred overnight. The resin was then filtered and washed with MeOH (100 mL) and the combined organic layers were concentrated to dryness to yield the desired sisomicin (11.57 g, 0.026 mol, 89.6% yield): MS m/e [M+H]⁺ calcd 448.3, found 448.1.

 

Example 1 6′-(2-Hydroxy-ethyl)-1-(4-amino-2(S)-hydroxy-butyryl)-sisomicin

 

 

6′-(2-tert-Butyldimethylsililoxy-ethyl)-2′,3,3″-triBoc-1-(N-Boc-4-amino-2(S)-hydroxy-butyryl)-sisomicin

2′,3,3″-triBoc-1-(N-Boc-4-amino-2(S)-hydroxy-butyryl)-sisomicin (0.10 g, 0.105 mmol) was treated with tert-butyldimethylsilyloxy acetaldehyde following Procedure 1-Method A to yield the desired 6′-(2-tert-butyldimethylsilyloxy-ethyl)-2′,3,3″-triBoc-1-(N-Boc-4-amino-2(S)-hydroxy-butyryl)-sisomicin (MS m/e [M+H]⁺ calcd 1107.6, found 1107.4), which was carried through to the next step without further purification.

 

 

6′-(2-Hydroxy-ethyl)-1-(4-amino-2(S)-hydroxy-butyryl)-sisomicin

6′ -(2-tert-butyldimethylsililoxy-ethyl)-2′,3,3″-triBoc-1-(N-Boc-4-amino-2(S)-hydroxy-butyryl)-sisomicin (0.105 mmol) was submitted to Procedure 3-Method B for Boc removal to yield a crude, which was purified by RP HPLC Method 1-Column A to yield 6′-(2-hydroxy-ethyl)-1-(4-amino-2(S)-hydroxy-butyryl)-sisomicin: MS m/e [M+H]⁺ calcd 593.3, found 593.2, [M+Na]⁺615.3 ; CLND 97.5% purity.

1. Achaogen. Study for the treatment of complicated urinary tract infection and acute pyelonephritis.Available online: http://www.clinicaltrials.gov/ct2/show/NCT01096849 (accessed on 11 April 2013).
2. Zhanel, G.G.; Lawson, C.D.; Zelenitsky, S.; Findlay, B.; Schweizer, F.; Adam, H.; Walkty, A.; Rubinstein, E.; Gin, A.S.; Hoban, D.J.; et al. Comparison of the next-generation aminoglycoside plazomicin to gentamicin, tobramycin and amikacin. Expert Rev. Anti-Infect. Ther. 2012, 10, 459–473, doi:10.1586/eri.12.25.
3. Endimiani, A.; Hujer, K.M.; Hujer, A.M.; Armstrong, E.S.; Choudhary, Y.; Aggen, J.B.; Bonomo, R.A. ACHN-490, a neoglycoside with potent in vitro activity against multidrug-resistant Klebsiella pneumoniae isolates. Antimicrob. Agents Chemother. 2009, 53, 4504–4507.
4. Achaogen. Achaogen pipeline. Available online: http://www.achaogen.com (accessed on 30 August 2012).
5. Achaogen. Achaogen Awarded $60M Contract Option by BARDA for the Clinical Development of Plazomicin. Available online: http://www.achaogen.com/news/151/15 (accessed on 19 June 2013).
6. Achaogen. Achaogen announces all objectives met in Phase 2 Plazomicin complicated urinary tract infections study and start of first-in-human study with ACHN-975. Available online: http://www.achaogen.com/uploads/news/id148/Achaogen_PressRelease_2012–05–15.pdf (accessed on 10 April 2013).
7. Achaogen. Achaogen Announces Agreement with FDA on a Special Protocol Assessment for a Phase 3 Clinical Trial of Plazomicin to Treat Infections Caused by Carbapenem-Resistant Enterobacteriaceae (CRE); Achaogen: San Francisco, CA, USA, 2013.
8. Comparison of the next-generation aminoglycoside plazomicin to gentamicin, tobramycin and amikacin

9. US2010099661	4-23-2010	ANTIBACTERIAL AMINOGLYCOSIDE ANALOGS

LCB01-0371

LegoChem Biosciences (South Korea)

Phase I, Gram-positive

LCB01-0371 is being developed by LegoChem Bio. This new oxazolidinone has improved activity against Gram-positive pathogens and has good pharmacokinetic profiles in animals [103].

The compound is under Phase I clinical development to assess the safety and tolerability of the compound. The company is currently recruiting participants to be part of the trial [103,104].

read

LCB01-0371 is a new oxazolidinone with cyclic amidrazone. In vitro activity of LCB01-0371 against 624 clinical isolates was evaluated and compared with those of linezolid, vancomycin, and other antibiotics. LCB01-0371 showed good activity against Gram-positive pathogens. In vivo activity of LCB01-0371 against systemic infections in mice was also evaluated. LCB01-0371 was more active than linezolid against these systemic infections. LCB01-0371 showed bacteriostatic activity against Staphylococcus aureus.

watch outfor synthesis…will be updated

1. 103         Jeong, J.-W.; Jung, S.-J.; Lee, H.-H.; Kim, Y.-Z.; Park, T.-K.; Cho, Y.-L.; Chae, S.-E.; Baek, S.-Y.; Woo, S.-H.; Lee, H.-S.; et al. In vitro and In vivo activities of LCB01–0371, a new oxazolidinone. Antimicrob. Agents Chemother. 2010, 54, 5359–5362, doi:10.1128/AAC.00723-10.
2. 104          LegoChem Biosciences. Multiple ascendoing dose study for LCB01–0371. Available online: http://www.clinicaltrials.gov/ct2/show/NCT01842516 (accessed on 15 August 2013).
3. http://clinicaltrials.gov/ct2/show/NCT01842516
4. http://www.pubfacts.com/author/Yong+Zu+Kim
5. [PDF]

   7. 레고켐(임상).cdr

   http://www.kddf.org/common/file/?idx=1669&fname=7._레고켐(임상)…‎

   New oxazolidinone LCB01-0371 for MRSA and VRE infection. Young Lag Cho. Company : LegoChem Biosciences, Inc. Website : http://www.legochembio.com.

Eperezolid

radezolid

Ranbezolid

Sutezolid

linezolid

BC-3781

Topical pleuromutilin antibiotic agent

Gram-positive, including MRSA, PHASE 2 COMPLETED

Nabriva (Austria)

BC-3781
The pleuromutilin BC-3781 belongs to the first generation of pleuromutilins to combine excellent oral
bioavailability with substantial activity against Gram-positive pathogens and atypicals as well as some
Gram-negative pathogens. In particular, BC-3781 is highly active against multi-drug resistant (MDR)
pathogens including methicillin resistant Staphylococcus aureus (MRSA), MDR Streptococcus pneumonia
(i.e. macrolide and quinolone resistance), and vancomycin resistant Enterococcus faecium. It is
characterized by excellent in vivo activities (e.g. pneumonia model), outstanding PK/PD parameters,
allowing once a day dosing, and a novel mode of action. BC-3781 is being developed for both oral and IV
administration and is intended for the treatment of serious multi-drug resistant skin & skin structure
infections (CSSI) and moderate to severe pneumonia (CAP, HAP etc).

Pleuromutilins have been known since 1951, but only entered the market in 2007 with the approval of retapamulin for topical use. Until today, there are no pleuromutilins for systemic use approved in human clinical practice.

Nabriva is currently working on the development of new compounds is this class. The lead compound, BC-3781, if approved, will be the first pleuromutilin for systemic use in humans.

The compound shows potent in vitro activity against a large collection of staphylococci, streptococci, andE. faecium. When compared to linezolid and vancomycin, the compound shows greater overall potency againstS. aureus [121]. BC-3781 shows improved activity against most bacteria commonly associated with community-acquired respiratory tract infections, the compound is especially potent against S. pneumoniaincluding penicillin resistant strains. It also shows improved activity against H. influenza, M. catarrhalis, M. pneumoniae and C. pneumoniae.

BC-3781 is undergoing Phase I clinical trials for CAP and in March of 2011 has completed a Phase II clinical study comparing it to vancomycin for treatment of aBSSSI [119,120,121,122,123]. Nabriva Therapeutics AG announced that the cooperation with Forest Laboratories to develop the compound had elapsed, and that Nabriva retained all rights in BC-3781. The company informed that the product was Phase III ready and that it was seeking partners to continue further development [203].

Nabriva is also developing BC-7013 for topical use against Gram-positive infections and working on the discovery of new pleuromutilins [119,124].

Dr William Prince, CMO Nabriva Therapeutics commented:
“This is the first patient study with a systemic pleuromutilin. It will be an important proof of concept
for an exciting new class of antibiotics. The phase II study builds on our extensive preclinical and
phase I data which have demonstrated that BC-3781 can achieve therapeutically relevant blood and
tissue levels in man with excellent tolerability when administered by either oral or intravenous
routes.”

Dr. David Chiswell, CEO Nabriva Therapeutics commented:
“With a worldwide problem due to antibiotic resistant bacteria, there is a very significant need for
new classes of antibiotics with unique modes of action such as the pleuromutilins. The commercial
prospects for BC-3781 as the leading compound of an exciting new class are excellent, especially as it
has an ideal anti-bacterial spectrum for both skin and respiratory infections and is being developed
with both oral and intravenous formulations”

BC-3781 is highly active against key pathogens, including MRSA, associated with skin infections and
community and hospital acquired pneumonia and is more potent than Linezolid and vancomycin. The
compound’s novel mode of action ensures that it overcomes resistance mechanisms affecting all
approved classes of antibiotics. BC-378

About Nabriva Therapeutics
Nabriva Therapeutics is a biotechnology company focused on developing a new class of antibiotics for
the treatment of serious infections caused by resistant pathogens. Nabriva’s lead systemic product,
BC-3781, is being developed for the treatment of serious skin infections and bacterial pneumonia
caused by S. aureus, , S. pneumoniae, H. influenza, Mycoplasma, Legionella and other bacteria,
including drug resistant strains such as MRSA and vancomycin resistant E. faecium. In addition,
Nabriva Therapeutics’ topical pleuromutilin product candidate, BC-7013, is in clinical phase I. Nabriva
Therapeutics has a proven track record in world-class medicinal chemistry, clinical expertise, a
seasoned management team and solid IP. Nabriva Therapeutics is located in Vienna, Austria.

For more information on Nabriva please visit http://www.nabriva.com.

REF

http://www.phase4-partners.com/wp-content/uploads/2013/09/100412.pdf

http://www.glsv-vc.com/downloads/2010-06-02_First%20Patient_PressRelease.pdf

119

Nabriva. Pleuromutilins. Available online: http://www.nabriva.com/programs/pleuromutilins/ (accessed on 7 December 2012).
120

Forest Laboratories. Our pipeline: Solid, and set for further growth. Available online: http://www.frx.com/research/pipeline.aspx (accessed on 13 April 2013).
121

Sader, H.S.; Biedenbach, D.J.; Paukner, S.; Ivezic-Schoenfeld, Z.; Jones, R.N. Antimicrobial activity of the investigational pleuromutilin compound BC-3781 tested against Gram-positive organisms commonly associated with acute bacterial skin and skin structure infections. Antimicrob. Agents Chemother. 2012,56, 1619–1623, doi:10.1128/AAC.05789-11.

122
Sader, H.S.; Paukner, S.; Ivezic-Schoenfeld, Z.; Biedenbach, D.J.; Schmitz, F.J.; Jones, R.N. Antimicrobial activity of the novel pleuromutilin antibiotic BC-3781 against organisms responsible for community-acquired respiratory tract infections (CARTIs). J. Antimicrob. Chemother. 2012, 67, 1170–1175, doi:10.1093/jac/dks001.

123
Nabriva Therapeutics AG. Study comparing the safety and efficacy of two doses of BC-3781 vs. vancomycin in patients with acute bacterial skin and skin structure infection (ABSSSI). Available online: http://www.clinicaltrials.gov/ct2/show/NCT01119105 (accessed on 13 April 2013).

124
Novak, R. Are pleuromutilin antibiotics finally fit for human use? Ann. NY Acad. Sci. 2011, 1241, 71–81, doi:10.1111/j.1749-6632.2011.06219.x.

valnemulin

retapamulin

Radezolid

869884-78-6 cas no

http://www.ama-assn.org/resources/doc/usan/radezolid.pdf

Rib-X Pharmaceuticals

Phase II completed

N-{[(5S)-3-(2-fluoro-4′-{[(1H-1,2,3-triazol-5-ylmethyl)amino]methyl}biphenyl-4-yl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide

(5S)-N-[3-(2-Fluoro-4′-{[(1H-[1,2,3]triazol-4-ylmethyl)-amino]-methyl}-biphenyl-4-yl)-2-oxo-oxazolidin-5-ylmethyl]-acetamide

Rib-X Pharmaceuticals has completed two Phase II clinical trials of radezolid for the treatment of pneumonia and uncomplicated skin infections. The trial completion dates were in 2008 and 2009, but to date the Phase III trials have not been initiated [1-6].

Radezolid (INN, codenamed RX-1741) is a novel oxazolidinone antibiotic being developed by Rib-X Pharmaceuticals, Inc. for the treatment of serious multi-drug–resistant infections. Radezolid has completed two phase-II clinical trials. One of these clinical trials was for uncomplicated skin and skin-structure infections (uSSSI) and the other clinical trial was for community acquired pneumonia (CAP).

http://www.google.co.il/patents/WO2005019211A2?hl=iw&cl=en

SCheme A

Scheme B illustrates the synthesis of intermediates 7 and 8 of the present invention using Suzuki coupling chemistry between boronic acids and aryl triflates. Boronic ester 6 is treated with an appropriate aryl triflate to yield the BOC-protected biaryl 7. The BOC group of 7 is removed to provide amine 8, an intermediate useful in the synthesis of certain compounds of the present invention.

Scheme B

8, R = NH₂-HCI Scheme C depicts the synthesis of intermediates 9-13, which are useful in producing certain methoxy-substituted biaryl derivatives of the present invention. Suzuki coupling of boronic ester 6 produces biaryl aldehyde 9, which can be reduced to alcohol 10. Mesylation of 10 yields 11 that can be converted to azide 12. Reduction of azide 12 yields amine 13.

Scheme C

Scheme D depicts the synthesis of pyridyl intermediates, which are useful for the synthesis of compounds of the present invention, via similar chemistry to that shown in Scheme C. Coupling of boronic ester 6 to a halopyridine aldehyde produces biaryl aldehyde 14. Aldehyde 14 serves as the precursor to intermediates 15-18 via chemistry described above.

Scheme D

Biaryl aldehyde 19 (Scheme E) can be synthesized from a Suzuki coupling of iodide 1 and 4-formylphenylboronic acid. Scheme E illustrates how intermediate aldehydes of type 19, 9, and 14 can be converted via reductive amination chemistry to other amines, such as amines 20-22, which are useful as intermediates for the synthesis of certain compounds of the invention.

Scheme E

Scheme F depicts the general synthesis of compounds of type la and lb from amines of type 5, 13, 18, and 20-22. Compounds of type la and lb are synthesized via acylation of amines 5, 13 and 18 and 20-22 with the appropriate acids using, for example, l-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI) as the coupling agent. Compounds 4001-4007 were specifically synthesized from amine 5 and the appropriate carboxylic acids. Scheme F

Scheme G highlights the synthesis of compounds of general structure II from amines of type 5 and 18. The amine can be acylated with carboxylic acids using EDCI (or other commonly employed peptide coupling reagents known in the art) to afford amides II. Acid chlorides can be purchased or synthesized and allowed to react with amines 5 and 18, in the presence of bases such as triethylamine, to also produce amides II. Alternatively, carboxylic acids can be pre-loaded onto a solid polymeric support, such as a tetrafluorophenol containing resin (TFP resin), and reacted with amines to yield amide products of general structure II (such as compounds 4008-4015).

Scheme G

Scheme H illustrates the synthesis of compounds of general structure Ilia from amines of type 5, 13, and 18 using reductive amination chemistry. For example, biaryl amine compounds 4016-4028 are synthesized in this manner. Scheme H

Scheme I depicts the synthesis of general structure Illb of the present invention from amine intermediate 8. For example, compounds 4029-4031 are synthesized using this reductive amination chemistry.

Scheme I

Scheme J shows the synthesis of compounds of general structure IVa and IVb. Amines 20, 21, and 22 can be converted to tertiary amines IVa, such as compounds 4032-4034 and 4036, using standard reductive amination chemistry employed earlier for other derivatives. This reductive amination chemistry can be employed on biaryl aldehyde intermediates such as 19, 9, and 14 to yield optionally substituted amines of general structure IVb, illustrated by compound 4037.

Scheme J

producing compounds of the present invention. Known iodoaryl oxazolidinone intermediate 50 (see U.S. Patent Nos. 5,523,403 and 5,565,571) is coupled to a substituted aryl boronic acid (the Suzuki reaction) to produce biaryl alcohol 51. Mesylate 52, azide 53, and amine 54 are then synthesized using chemistry well known to those skilled in the art. Scheme 1

NaN₃, DMF, 70 °C

http://www.google.co.il/patents/WO2005019211A2?hl=iw&cl=en

……………….

http://www.google.com/patents/US20100234615

TABLE 1
Compound
Number	Structure
1

Example 1 Synthesis of Compound 1

Compound 1 and its hydrochloride salt are synthesized according to the following Scheme:

4-Methoxybenzyl Azide

1001.

A solution of 4-methoxybenzyl chloride 1000 (51.8 g, 331.0 mmol) in anhydrous DMF (200 mL) was treated with solid sodium azide (21.5 g, 331.0 mmol, 1.0 equiv) at 25° C., and the resulting mixture was stirred at 25° C. for 24 h. When TLC and HPLC/MS showed that the reaction was complete, the reaction mixture was quenched with H₂O (400 mL) and ethyl acetate (EtOAc, 400 mL) at room temperature.

The two layers were separated, and the aqueous layer was extracted with EtOAc (200 mL). The combined organic extracts were washed with H₂O (2×200 mL) and saturated NaCl aqueous solution (100 mL), dried over MgSO₄, and concentrated in vacuo. The crude 4-methoxybenzyl azide (51.2 g, 53.95 g theoretical, 94.9% yield) was obtained as colorless oil, which by HPLC and ¹H NMR was found to be essentially pure and was directly used in the subsequent reaction without further purifications. For 4-methoxybenzyl azide 1001:

¹H NMR (300 MHz, CDCl₃) δ 3.84 (s, 3H, ArOCH₃), 4.29 (s, 2H, Ar—CH₂), 6.96 (d, 2H, J=8.7 Hz), 7.28 (d, 2H, J=7.8 Hz).

C-[1-(4-Methoxy-benzyl)-1H-[1,2,3]triazol-4-yl]-methylamine and C-[3-(4-Methoxy-benzyl)-3H-[1,2,3]triazol-4-yl]-methylamine

(1003 and 1004).

A solution of 4-methoxybenzyl azide 1001 (61.2 g, 375.5 mmol) in toluene (188 mL) was heated with propargylamine 1002 (commercially available, 30.97 g, 38.6 mL, 563.0 mmol, 1.5 equiv) at 25° C., and the resulting reaction mixture was warmed up to gentle reflux at 100-110° C. for 21 h. When TLC and HPLC/MS showed that the reaction was complete, the reaction mixture was cooled down to room temperature before being concentrated in vacuo to remove the excess amount of propargylamine and solvent.

The oily residue was then treated with 30% ethyl acetate-hexane (v/v, 260 mL), and the resulting mixture was warmed up to reflux and stirred at reflux for 30 min before being cooled down to room temperature for 1 h. The pale-yellow solids were then collected by filtration, washed with 30% ethyl acetate-hexane (v/v, 2×100 mL), and dried in vacuo at 40° C. for overnight to afford the crude, cycloaddition product (78.8 g, 81.75 g theoretical, 96.4%) as a mixture of two regioisomers, C-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-yl]-methylamine and C-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-yl]-methylamine (1003 and 1004), in a ratio of 1.2 to 1 by ¹H NMR.

The crude cycloaddition product was found to be essentially pure and the two regioisomers were not separated before being used directly in the subsequent reaction without further purification. For 1003 and 1004:

¹H NMR (300 MHz, DMSO-d₆) δ 1.82 (br. s, 2H, NH₂), 3.72 and 3.73 (two s, 3H, Ar—OCH₃), 5.47 and 5.53 (two s, 2H, ArCH₂), 6.89 and 6.94 (two d, 2H, J=8.7 Hz, Ar—H), 7.17 and 7.29 (two d, 2H, J=8.7 Hz, Ar—H), 7.58 and 7.87 (two br. s, 1H, triazole-CH); C₁₁H₁₄N₄O, LCMS (EI) m/e 219 (M⁺+H) and 241 (M⁺+Na).

4-({tert-Butoxycarbonyl-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid and 4-({tert-Butoxycarbonyl-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid (1008 and 1009).

Method A. A solution of the regioisomeric C-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-yl]-methylamine and C-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-yl]-methylamine (1003 and 1004, 20.0 g, 91.74 mmol) in 1,2-dichloroethane (DCE, 280 mL) was treated with 4-formylphenylboronic acid 1005 (commercially available, 12.39 g, 82.57 mmol, 0.9 equiv) at room temperature, and the resulting reaction mixture was stirred at room temperature for 10 min. Sodium triacetoxyborohydride (NaB(OAc)₃H, 29.2 g, 137.6 mmol, 1.5 equiv) was then added to the reaction mixture in three portions over the period of 1.5 h at room temperature, and the resulting reaction mixture was stirred at room temperature for an additional 3.5 h.

When TLC and HPLC/MS showed that the reductive animation reaction was complete, the reaction mixture was concentrated in vacuo. The residue, which contained a regioisomeric mixture of 4-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid and 4-({[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid as the reductive animation products (1006 and 1007), was then treated with tetrahydrofuran (THF, 100 mL) and water (H₂O, 100 mL).

The resulting solution was subsequently treated with solid potassium carbonate (K₂CO₃, 37.98 g, 275.2 mmol, 3.0 equiv) and di-tert-butyl dicarbonate (BOC₂O, 20.02 g, 91.74 mmol, 1.0 equiv) at room temperature and the reaction mixture was stirred at room temperature for 2 h. When TLC and HPLC/MS showed that the N-BOC protection reaction was complete, the reaction mixture was treated with ethyl acetate (EtOAc, 150 mL) and water (H₂O, 100 mL). The two layers were separated, and the aqueous layer was extracted with ethyl acetate (50 mL). The combined organic extracts were washed with H₂O (50 mL), 1.5 N aqueous HCl solution (2×100 mL), H₂O (100 mL), and saturated aqueous NaCl solution (100 mL), dried over MgSO₄, and concentrated in vacuo.

The crude, regioisomeric 4-({tert-butoxycarbonyl-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid and 4-({tert-butoxycarbonyl-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid (1008 and 1009, 35.98 g, 37.32 g, 96.4%) was obtained as a pale-yellow oil, which solidified upon standing at room temperature in vacuo.

This crude material was directly used in the subsequent reaction without further purification. For 1008 and 1009:

¹H NMR (300 MHz, DMSO-d₆) δ 1.32 and 1.37 (two br. s, 9H, COOC(CH₃)₃), 3.70, 3.73 and 3.74 (three s, 3H, Ar—OCH₃), 4.07-4.39 (m, 4H), 5.49 and 5.52 (two s, 2H), 6.70-8.04 (m, 9H, Ar—H and triazole-CH); C₂₃H₂₉BN₄O₅, LCMS (EI) m/e 453 (M⁺+H) and 475 (M⁺+Na).

Method B. A solution of the regioisomeric C-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-yl]-methylamine and C-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-yl]-methylamine (1003 and 1004, 20.06 g, 92.0 mmol) in tetrahydrofuran (THF, 300 mL) was treated with 4-formylphenylboronic acid (13.11 g, 87.4 mmol, 0.95 equiv) at room temperature, and the resulting reaction mixture was stirred at room temperature for 10 min. Sodium triacetoxyborohydride (NaB(OAc)₃H, 29.25 g, 138.0 mmol, 1.5 equiv) was then added to the reaction mixture in three portions over the period of 1.5 h at room temperature, and the resulting reaction mixture was stirred at room temperature for an additional 3.5 h.

When TLC and HPLC/MS showed that the reductive animation reaction was complete, the reaction mixture, which contained a regioisomeric mixture of 4-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid and 4-({[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid as the reductive animation products (1006 and 1007), was then treated with water (H₂O, 200 mL).

The resulting aqueous solution was subsequently heated with solid potassium carbonate (K₂CO₃, 38.0 g, 276 mmol, 3.0 equiv) and di-tert-butyl dicarbonate (BOC₂O, 20.08 g, 92 mmol, 1.0 equiv) at room temperature and the reaction mixture was stirred at room temperature for 2 h. When TLC and HPLC/MS showed that the N-BOC protection reaction was complete, the reaction mixture was treated with ethyl acetate (EtOAc, 150 mL) and water (H₂O, 100 mL). The two layers were separated, and the aqueous layer was extracted with ethyl acetate (50 mL).

The combined organic extracts were washed with H₂O (50 mL), 1.5 N aqueous HCl solution (2×100 mL), H₂O (100 mL), and saturated aqueous NaCl solution (100 mL), dried over MgSO₄, and concentrated in vacuo. The crude, 4-({tert-butoxycarbonyl-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid and 4-({tert-butoxycarbonyl-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid (1008 and 1009, 38.45 g, 39.50 g, 97.3%) was obtained as a pale-yellow oil, which solidified upon standing at room temperature in vacuo. This crude material was found to be essentially identical in every comparable aspect as the material obtained from Method A and was directly used in the subsequent reaction without further purification.

(5S)-{4′-[5-(Acetylamino-methyl)-2-oxo-oxazolidin-3-yl]-2′-fluoro-biphenyl-4-ylmethyl}-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-carbamic acid tert-butyl ester and (5S)-{4′-[5-(Acetylamino-methyl)-2-oxo-oxazolidin-3-yl]-2′-fluoro-biphenyl-4-ylmethyl}-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-5-ylmethyl]-carbamic acid tert-butyl ester

(1011 and 1012).

A suspension of the crude regioisomeric mixture of 4-({tert-butoxycarbonyl-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid and 4-({tert-butoxycarbonyl-[3-(4-methoxy-benzyl)-3H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-phenylboronic acid (1008 and 1009, 37.62 g, 83.23 mmol) and N-[3-(3-fluoro-4-iodo-phenyl)-2-oxo-oxazolidin-5-ylmethyl]-acetamide (1010, 28.32 g, 74.9 mmol, 0.90 equiv) in toluene (150 mL) was treated with powder K₂CO₃ (34.45 g, 249.7 mol, 3.0 equiv), EtOH (50 mL), and H₂O (50 mL) at 25° C.,

and the resulting mixture was degassed three times under a steady stream of Argon at 25° C. Pd(PPh₃)₄ (866 mg, 0.749 mmol, 0.01 equiv) was subsequently added to the reaction mixture, and the resulting reaction mixture was degassed three times again under a stead stream of Argon at 25° C. before being warmed up to gentle reflux for 18 h. When TLC and HPLC/MS showed the coupling reaction was complete, the reaction mixture was cooled down to room temperature before being treated with H₂O (100 mL) and ethyl acetate (100 mL). The two layers were then separated, and the aqueous layer was extracted with EtOAc (100 mL).

The combined organic extracts were washed with H₂O (50 mL), 1.5 N aqueous HCl solution (2×150 mL), H₂O (100 mL), and the saturated aqueous NaCl solution (100 mL), dried over MgSO₄, and concentrated in vacuo. The residual oil was solidified upon standing at room temperature in vacuo to afford the crude, (5S)-{4′-[5-(acetylamino-methyl)-2-oxo-oxazolidin-3-yl]-2′-fluoro-biphenyl-4-y]methyl}-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-carbamic acid tert-butyl ester (1011) and (5S)-{4′-[5-(acetylamino-methyl)-2-oxo-oxazolidin-3-yl]-2′-fluoro-biphenyl-4-ylmethyl}-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-5-ylmethyl]-carbamic acid tert-butyl ester (1012) as a regioisomeric mixture.

This crude product (43.36 g, 49.28 g theoretical, 88%) was used directly in the subsequent reaction without further purification. For the mixture of 1011 and 1012: ¹H NMR (300 MHz, DMSO-d₆) δ 1.35 and 1.38 (two br. s, 9H, COO(CH₃)₃), 1.85 (s, 3H, COCH₃), 3.45 (t, 2H, J=5.4 Hz), 3.73 and 3.76 (two s, 3H, Ar—OCH₃), 3.79 (dd, 1H, J=6.6, 9.1 Hz), 4.18 (t, 1H, J=9.1 Hz), 4.35-4.43 (m, 4H), 4.73-4.81 (m, 1H), 5.50 (br. s, 2H), 6.90 and 6.98 (two d, 2H, J=8.7 Hz), 7.28 and 7.32 (two d, 2H, J=8.7 Hz), 7.35 (dd, 2H, J=2.2, 8.6 Hz), 7.42 (dd, 1H, J=2.2, 8.6 Hz), 7.49-7.63 (m, 4H, aromatic-H), 7.90 and 7.99 (two br. s, 1H, triazole-CH), 8.29 (t, 1H, J=5.8 Hz, NHCOCH₃); C₃₅H₃₉FN₆O₆, LCMS (EI) m/e 659 (M⁺+H) and 681 (M⁺+Na).

(5S)-N-{3-[2-Fluoro-4′-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-biphenyl-4-yl]-2-oxo-oxazolidin-5-ylmethyl}-acetamide Hydrochloride (1013)

and

(5S)-N-{3-[2-Fluoro-4′-({[1-(4-methoxy-benzyl)-1H--[1,2,3]triazol-5-ylmethyl]-amino}-methyl)-biphenyl-4-yl]-2-oxo-oxazolidin-5-ylmethyl}-acetamide Hydrochloride (1014).

A solution of a regioisomeric mixture of (5S)-{4′-[5-(acetylamino-methyl)-2-oxo-oxazolidin-3-yl]-2′-fluoro-biphenyl-4-ylmethyl}-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-carbamic acid tert-butyl ester and (5S)-{4′-[5-(acetylamino-methyl)-2-oxo-oxazolidin-3-yl]-2′-fluoro-biphenyl-4-ylmethyl}-[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-5-ylmethyl]-carbamic acid tert-butyl ester (1011 and 1012, 37.28 g, 56.65 mmol) in ethyl acetate (EtOAc, 150 mL) and methanol (MeOH, 30 mL) was treated with a solution of 4 N hydrogen chloride in 1,4-dioxane (113.3 mL, 453.2 mmol, 8.0 equiv) at room temperature, and the resulting reaction mixture was stirred at room temperature for 12 h. When TLC and HPLC/MS showed that the N-BOC deprotection reaction was complete,

the solvents were removed in vacuo. The residue was then suspended in 250 mL of 5% methanol (MeOH) in acetonitrile (CH₃CN), and the resulting slurry was stirred at room temperature for 1 h. The solids were then collected by filtration, washed with toluene (2×100 mL) and 5% methanol in acetonitrile (2×50 mL), and dried in vacuo to afford a regioisomeric mixture of the crude, (5S)-N-{3-[2-fluoro-4′-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-biphenyl-4-yl]-2-oxo-oxazolidin-5-ylmethyl}-acetamide hydrochloride and (5S)-N-{3-[2-fluoro-4′-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-5-ylmethyl]-amino}-methyl)-biphenyl-4-yl]-2-oxo-oxazolidin-5-ylmethyl}-acetamide hydrochloride (1013 and 1014, 30.0 g, 33.68 g theoretical, 89.1% yield) as off-white crystals in a ratio of 1.2 to 1.

This material was found by ¹H NMR and HPLC/MS to be essentially pure and was directly used in the subsequent reactions without further purification. For the regioisomeric mixture of 1013 and 1014:

¹H NMR (300 MHz, DMSO-d₆) δ 1.84 (s, 3H, COCH₃), 3.44 (t, 2H, J=5.4 Hz), 3.71 and 3.74 (two s, 3H, Ar—OCH₃), 3.80 (dd, 1H, J=6.6, 9.1 Hz), 4.17 (t, 1H, J=9.1 Hz), 4.23-4.30 (m, 4H), 4.73-4.80 (m, 1H), 5.58 and 5.70 (two s, 2H), 6.88 and 6.93 (two d, 2H, J=8.7 Hz), 7.15 and 7.32 (two d, 2H, J=8.7 Hz), 7.43 (dd, 2H, J=2.2, 8.6 Hz), 7.52-7.62 (m, 6H, aromatic-H), 8.28 (s, 1H, triazole-CH), 8.32 (t, 1H, J=5.8 Hz, NHCOCH₃), 9.91 and 10.32 (two br. s, 2H, ArCH₂N⁺H₂); C₃₀H₃₁FN₆O₄, LCMS (EI) m/e 559 (M⁺+H) and 581 (M⁺+Na).

(5S)-N-[3-(2-Fluoro-4′-{[(1H-[1,2,3]triazol-4-ylmethyl)-amino]-methyl}-biphenyl-4-yl)-2-oxo-oxazolidin-5-ylmethyl]-acetamide hydrochloride (1 hydrochloride salt).

A solution of the crude regioisomeric mixture of (5S)-N-{3-[2-fluoro-4′-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-4-ylmethyl]-amino}-methyl)-biphenyl-4-yl]-2-oxo-oxazolidin-5-ylmethyl}-acetamide hydrochloride and (5S)-1H-{3-[2-fluoro-4′-({[1-(4-methoxy-benzyl)-1H-[1,2,3]triazol-5-ylmethyl]-amino}-methyl)-biphenyl-4-yl]-2-oxo-oxazolidin-5-ylmethyl}-acetamide hydrochloride (1013 and 1014, 29.17 g, 49.07 mmol) in trifluoroacetic acid(TFA, 150 mL) was warmed up to 65-70° C., and the resulting reaction mixture was stirred at 65-70° C. for 12 h. When TLC and HPLC/MS showed that the deprotection reaction was complete, the solvents were removed in vacuo.

The residual solids were then treated with ethyl acetate (EtOAc, 100 mL) and H₂O (150 mL) before being treated with a saturated aqueous solution of sodium carbonate (30 mL) at room temperature. The resulting mixture was then stirred at room temperature for 1 h before the solids were collected by filtration, washed with EtOAc (2×50 mL) and H₂O (2×50 mL), and dried in vacuo at 40-45° C. to afford the crude, (5S)-N-[3-(2-fluoro-4′-{[(1H-[1,2,3]triazol-4-ylmethyl)-amino]-methyl)-biphenyl-4-yl)-2-oxo-oxazolidin-5-ylmethyl]-acetamide (1 as the free base, 18.9 g, 21.49 g theoretical, 87.9%) as off-white powders, which by HPLC/MS and ¹H NMR was found to be one pure regioisomer and this regioisomer was found to be identical as the material obtained from deprotection of 1013 alone by the same method.

For 1 as the free base: ¹H NMR (300 MHz, DMSO-d₆) δ 1.85 (s, 3H, COCH₃), 3.44 (t, 2H, J=5.4 Hz), 3.74 (s, 2H), 3.77 (s, 2H), 3.79 (dd, 1H, J=6.4, 9.2 Hz), 4.17 (t, 1H, J=9.1 Hz), 4.72-4.81 (m, 1H), 7.39-7.62 (m, 7H, aromatic-H), 7.73 (s, 1H, triazole-CH), 8.29 (t, 1H, J=5.8 Hz, NHCOCH₃), 9.72 (br. s, 2H, ArCH₂N⁺H₂), 15.20 (br. s, 1H, triazole-NH); C₂₂H₂₃FN₆O₃, LCMS (EI) m/e 439 (M⁺+H) and 461 (M⁺+Na).

A suspension of 1 free base (18.0 g, 41.1 mmol) in ethyl acetate (EtOAc, 80 mL), and methanol (MeOH, 20 mL) was treated with a solution of 4.0 N hydrogen chloride in 1,4-dioxane (41.1 mL, 164.4 mmol, 4.0 equiv) at room temperature, and the resulting mixture was stirred at room temperature for 8 h. The solvents were then removed in vacuo, and the residue was further dried in vacuo before being treated with a mixture of 10% methanol in acetonitrile (80 mL). The solids were collected by filtration, washed with 10% MeOH/acetonitrile (2×40 mL), and dried in vacuo to afford 1 hydrochloride salt (18.13 g, 19.50 g theoretical, 93% yield) as off-white crystals.

The crude 1 hydrochloride salt can be recrystallized from acetonitrile and water, if necessary, according to the following procedure: A suspension of the crude 1 hydrochloride salt (50.0 g) in acetonitrile (1250 mL) was warmed up to reflux before the distilled water (H₂O, 280 mL) was gradually introduced to the mixture. The resulting clear yellow to light brown solution was then stirred at reflux for 10 min before being cooled down to 45-55° C. The solution was then filtered through a Celite bed at 45-55° C., and the filtrates were gradually cooled down to room temperature before being further cooled down to 0-5° C. in an ice bath for 1 h. The solids were then collected by filtration, washed with acetonitrile (2×50 mL), and dried in vacuo at 40° C. for 24 h to afford the recrystallized 1 hydrochloride salt (42.5 g, 50.0 g theoretical, 85% recovery) as off-white crystals.

For 1: ¹H NMR (300 MHz, DMSO-d₆) δ 1.86 (s, 3H, COCH₃), 3.45 (t, 2H, J=5.4 Hz), 3.84 (dd, 1H, J=6.4, 9.2 Hz), 4.19 (t, 1H, J=9.1 Hz), 4.24 (br. s, 2H), 4.31 (br. s, 2H), 4.74-4.79 (m, 1H), 7.44 (dd, 1H, J=2.2, 8.6 Hz), 7.57-7.66 (m, 6H, aromatic-H), 8.17 (s, 1H, triazole-CH), 8.30 (t, 1H, J=5.8 Hz, NHCOCH₃), 9.72 (br. s, 2H, ArCH₂N⁺H₂), 15.20 (br. s, 1H, triazole-NH);

¹³C NMR (75 MHz, DMSO-d₆) δ 22.57, 40.69, 41.50, 47.36, 49.23, 71.85, 105.70 (d, J=28.5 Hz), 114.14 (d, J=2.9 Hz), 122.29 (d, J=13.3 Hz), 128.82 (d, J=3.0 Hz), 130.70, 130.94, 131.0, 131.22, 135.30, 137.92 (br. s), 139.66 (d, J=11.2 Hz), 154.11, 159.13 (d, J=243.5 Hz), 170.19;

C₂₂H₂₃FN₆O₃—HCl, LCMS (EI) m/e 439 (M⁺+H) and 461 (M⁺+Na).

References

• Radezolid at Rib-X Pharmaceuticals
• http://www.unil.ch/webdav/site/cnfmi/shared/abstracts_and_lectures/2009/3__F_van_Bambeke.pdf

1. Sutcliffe, J.A. Antibiotics in development targeting protein synthesis. Ann. NY Acad. Sci. 2011, 1241, 122–152, doi:10.1111/j.1749-6632.2011.06323.x.
2. Rib-X. Radezolid. Available online: http://www.rib-x.com/pipeline/radezolid.php#development (accessed on 14 April 2013).
3. Rib-X Pharmaceuticals, Inc. Safety and efficacy study of oxazolidinone to treat pneumonia. Available online: http://www.clinicaltrials.gov/ct2/show/NCT00640926 (accessed on 14 April 2013).
4. Rib-X Pharmaceuticals, Inc. Safety and efficacy study of oxazolidinones to treat uncomplicated skin infections. Available online: http://www.clinicaltrials.gov/ct2/show/NCT00646958 (accessed on 14 April 2013).
5. Shaw, K.J.; Barbachyn, M.R. The oxazolidinones: Past, present, and future. Ann. NY Acad. Sci. 2011, 1241, 48–70, doi:10.1111/j.1749-6632.2011.06330.x.
6. Skripkin, E.; McConnell, T.S.; DeVito, J.; Lawrence, L.; Ippolito, J.A.; Duffy, E.M.; Sutcliffe, J.; Franceschi, F. Rχ-01, a new family of oxazolidinones that overcome ribosome-based linezolid resistance.Antimicrob. Agents Chemother. 2008, 52, 3550–3557, doi:10.1128/AAC.01193-07.

October 10, 2012

QIDP Designation for Radezolid for Acute Bacterial Skin and Skin Structure Infections, Community-acquired Bacterial Pneumonia

Rib-X Pharmaceuticals announced that the FDA designated radezolid as a Qualified Infectious Disease Product (QIDP) for the indications of acute bacterial skin and skin structure infections (ABSSSI) and community-acquired bacterial pneumonia (CABP).

The QIDP designation will enable Rib-X to benefit from certain incentives for the development of new antibiotics, including an additional five years of market exclusivity, priority review and eligibility for fast-track status, provided under the new Generating Antibiotic Incentives Now (GAIN) program. GAIN was included in the FDA Safety and Innovation Act (FDASIA), formerly known as PDUFA V, which received bipartisan Congressional support and was signed into law by President Obama in July 2012.

Radezolid has completed two Phase 2 clinical trials with an oral formulation in uncomplicated skin and skin structure infections (uSSSI) and in CABP. A Phase 1 study with an IV formulation was recently completed in healthy subjects. Rib-X recently announced data from a positive Phase 1 IV dosing study conducted in healthy subjects and an in vivo long-term safety study vs. linezolid (Zyvox; Pfizer).

Radezolid is a next-generation oxazolidinone with a safety profile permitting long-term treatment of resistant infections, including those caused by methicillin-resistant Staphylococcus aureus (MRSA).

For more information call (203) 624-5606 or visit www.rib-x.com

POSIZOLID

252260-02-9  CAS NO

(5R)-3-[4-[1-[(2S)-2,3-Dihydroxypropanoyl]-3,6-dihydro-2H-pyridin-4-yl]-3,5-difluorophenyl]-5-(1,2-oxazol-3-yloxymethyl)-1,3-oxazolidin-2-one

AstraZeneca (Originator)

Posizolid is an oxazolidinone antibiotic under investigation by AstraZeneca for the treatment of bacterial infections. At a concentration of 2 mg/L it inhibited 98% of all Gram-positive bacteria tested in vitro.^[1]

Tuberculosis is a disease caused by Mycobacterium tuberculosis (Mtu), which in 1990 was declared a global epidemic by the World Health Organisation (WHO). It affects more than one third of the world’s population resulting in 8 million new patients and 2 million deaths every year. Also there exists a scenario called “Latent TB”, which occurs when germs remain in the body in a quiescent state but without any apparent effect on the health of the individual. In many cases this stage may last for many years or decades. In case of normal human being the chance of activation is 2-23% in a lifetime. However in case of immuno-compromised patients (like HIV) the chances of activation rise to 10% every year.

The current treatment of drug sensitive tuberculosis is at least six months long and requires a combination of isoniazid, rifampicin, pyrazinamide and ethambutol in the first two months followed by isoniazid and rifampicin for a period of four months. In recent years, drug resistance to these drugs has increased and the last of drugs for tuberculosis was introduced into clinical practice in the late 1960′s. The evolution of resistance could result in strains against which currently available antitubercular agents will be ineffective and treatment in such cases may last two years with no guarantee of cure. So there is an urgent need to introduce new drugs particularly those with either a novel mechanism of action and/or containing new pharmacophoric groups and new treatment regimens to overcome not only rising drug resistance but also improve the overall treatment duration.

R. Sood et al (Infectious Disorders—Drug Targets 2006, 343-354) report that “Oxazolidinones are a new class of totally synthetic antibacterial agents with wide spectrum of activity against a variety of clinically significant susceptible and resistant bacteria. These compounds have been shown to inhibit translation at the initiation phase of protein synthesis. DuP-721, the first oxazolidinone showed good activity against M. tuberculosis when given orally or parenterally to experimental animals but was not developed further due to lethal toxicity in animal models. Later two oxazolidinones, PNU-100480 and Linezolid, demonstrated promising antimycobacterial activities in the murine model. While Linezolid has been approved for clinical use for broad spectrum area, PNU-100840 was not developed further. DA-7867 showed good in vitro and better in vivo efficacy than Linezolid but was poorly tolerated in rat toxicology studies. The antimycobacterial activity of AZD2563 has not been explored. RBx 7644 had modest antimycobacterial activity whilst RBx 8700 has potent antibacterial and concentration dependent activity against all slow growing mycobacteria. It demonstrated better activity than RBx 7644 against MDR strains of M. tuberculosis along with intracellular activity”.

In published patent application WO-99/64417 we disclose the compound

ie. (5R)-3-[4-[1-[(2S)-2,3-dihydroxypropanoyl]-3,6-dihydro-2H-pyridin-4-yl]-3,5-difluoro-phenyl]-5-(isoxazol-3-yloxymethyl)oxazolidin-2-one also known as AZD2563. As reported by R. Sood et al (op cit) the antimycobacterial activity of AZD2563 has not been explored.

In a first aspect of the invention we now provide (5R)-3-[4-[1-[(2S)-2,3-dihydroxypropanoyl]-3,6-dihydro-2H-pyridin-4-yl]-3,5-difluoro-phenyl]-5-(isoxazol-3-yloxymethyl)oxazolidin-2-one or a pharmaceutically-acceptable salt, or an in-vivo-hydrolysable ester thereof, for use in the treatment of Mycobacterium tuberculosis.

The compound can form stable acid or basic salts, and in such cases administration of a compound as a salt may be appropriate, and pharmaceutically acceptable salts may be made by conventional methods such as those described following.

Suitable pharmaceutically-acceptable salts include acid addition salts such as methanesulfonate, tosylate, α-glycerophosphate. fumarate, hydrochloride, citrate, maleate, tartrate and hydrobromide. Also suitable are salts formed with phosphoric and sulfuric acid. In another aspect suitable salts are base salts such as an alkali metal salt for example sodium, an alkaline earth metal salt for example calcium or magnesium, an organic amine salt for example triethylamine, morpholine, N-methylpiperidine, N-ethylpiperidine, procaine, dibenzylamine, N,N-dibenzylethylamine, tris-(2-hydroxyethyl)amine, N-methyl d-glucamine and amino acids such as lysine. There may be more than one cation or anion depending on the number of charged functions and the valency of the cations or anions. In one aspect of the invention the pharmaceutically-acceptable salt is the sodium salt.

Synthesis of 5R)-3-[4-[1-[(2S)-2,3-dihydroxypropanoyl]-3,6-dihydro-2H-pyridin-4-yl]-3,5-difluoro-phenyl]-5-(isoxazol-3-yloxymethyl)oxazolidin-2-one (AZD 2563) is disclosed in our published patent application WO-99/64417.

……………….

http://www.google.com/patents/WO1999064417A2?cl=en

Example 22: 5(R)-IsoxazoI-3-yloxymethyl-3-(4-(l-(2(S)-hvdroxy-3-phosphoryl- propanovD-l^_^S^-tetrahvdropyrid^-vπ^^-difluorophenvDoxazolidin^-one

To a stiπed solution of the starting material Reference Example 15 (lOOmg, 0.15mmol) in dioxan (1ml) was added 4M HCl / dioxan (3ml). The solution was stiπed at ambient temperature for 30 mins. and then evaporated. The residue was triturated well with ether giving the title compound as a white powder (80mg, 96%).

NMR (300Mz. DMS0-d6): 2.43 (m, partially obscured), 3.6 – 4.35 (m, 8H), 4.35 – 4.60 (m, 3H), 5.09 (m, IH), 5.85 (s, IH), 6.30 (s, IH), 7.31 (d, 2H), 8.60 (s, IH). MS: ESP+ (M+H) = 546.

…………………….

EP 1082323; JP 2002517498; WO 9964417

The condensation of the protected 3,5-difluoroaniline (I) with 1-benzyl-4-piperidone (II) by means of BuLi in THF gives 4-(1-benzyl-4-hydroxypiperidin-4-yl)-3,5-difluoroaniline (III), which is dehydrated with refluxing conc. HCl to yield the tetrahydropyridine (IV). The reaction of (IV) with benzyl chloroformate in acetone/water affords the carbamate (V), which is cyclized with (R)-glycidyl butyrate (VI) by means of BuLi in THF to provide the oxazolidinone (VII). The condensation of (VII) with isoxazol-3-ol (VIII) by means of PPh3 and DIAD in THF gives the expected ether adduct (IX), which is debenzylated by reaction with 1-chloroethyl chloroformate in dichloromethane, yielding the free tetrahydropyridine derivative (X). The condensation of (X) with (S)-2,3-O-isopropylideneglyceric acid (XI) by means of DEC or DCC and TEA in dichloromethane affords the corresponding acyl tetrahydropyridine (XII), which is finally deprotected with HCl in THF to provide the target dihydroxy compound.

………………..

WO 0140236

The condensation of the protected 3,5-difluoroaniline (I) with 1-benzyl-4-piperidone (II) by means of BuLi in THF gives 4-(1-benzyl-4-hydroxypiperidin-4-yl)-3,5-difluoroaniline (III), which is dehydrated with refluxing conc. HCl to yield the tetrahydropyridine (IV). The reaction of (IV) with benzyl chloroformate in acetone/water affords the carbamate (V), which is cyclized with (R)-glycidyl butyrate (VI) by means of BuLi in THF to provide the oxazolidinone (VII). The condensation of (VII) with isoxazol-3-ol (VIII) by means of PPh3 and DIAD in THF gives the expected ether adduct (IX), which is debenzylated by reaction with 1-chloroethyl chloroformate in dichloromethane, yielding the free tetrahydropyridine derivative (X). The condensation of (X) with (S)-2,3-O-isopropylideneglyceric acid (XI) by means of DEC or DCC and TEA in dichloromethane affords the corresponding acyl tetrahydropyridine (XII), which is finally deprotected with HCl in THF to provide the target dihydroxy compound.

References

MRX I

MRX-I

1112968-42-9  cas no

C₁₈ H₁₅ F₃ N₄ O₄

• 4(1H)​-​Pyridinone, 2,​3-​dihydro-​1-​[2,​3,​6-​trifluoro-​4-​[(5S)​-​5-​[(3-​isoxazolylamino)​methyl]​-​2-​oxo-​3-​oxazolidinyl]​phenyl]​-

IN phase 1 FOR GRAM POSITIVE BACTERIA

MicuRx Pharmaceuticals (USA)

MicuRx Pharmaceuticals is developing two oxazolidinone compounds MRX-I and MRX-II. MRX-I is an oral oxazolidinone antibiotic that targets infections due to resistant Gram-positive bacteria, including MRSA and vancomycin-resistant enterococci (VRE). The company announced the completion of a double-blinded, placebo-controlled Phase 1 clinical study, and that the compound has been shown to be safe and well-tolerated at all doses tested with no evidence of myelosuppression.

In October 2012, the company announced the establishment of Shanghai MengKe Pharmaceuticals, a joint venture with Shanghai Zhangjiang Biomedical Industry Venture Capital formed to fund the development and commercialization of MRX-I for the Chinese market. MRX-II is currently under pre-clinical development [1,2].

MRX-I: A Potent and Safe Oxazolidinone Antibiotic

MRX-I is a next-generation oral oxazolidinone antibiotic for treating Gram-positivebacterial infections, including methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE). In April 2012, MicuRx announced positive Phase I clinical results demonstrating that MRX-I is safe and well tolerated in human subjects, with no signs of myelosuppression, a major toxicity concern for most oxazolidinone agents, including linezolid.In preclinical studies, MRX-I cures in vivoinfections due to Gram-positive bacteria including MRSA and VRE effectively. In addition, MRX-I exhibits 2-fold improved activity against MRSA strains as compared to linezolid.

WO 2009020616  OR

http://www.google.fm/patents/US20090048305?cl=ja

Example 1 Compound of Structure

Scheme for the Compound of Example 1

Intermediate 17. 2,3,4,5-Tetrafluoronitrobenzene (1.17 g, 6.0 mmol) in N-methylpiperidone (NMP; 25 mL) was added dropwise with stirring to 4-piperidone hydrochloride (0.84 g, 6.2 mmol) and N,N-diisopropyl-N-ethylamine (DIEA; 2.45 mL, 14.0 mmol) in NMP (20 mL) at ca.-10 to −5° C. under nitrogen. The mixture was allowed to warm up to r.t. and stirred o.n. The mixture was taken into EtOAc (ca. 100 mL), washed with 2% aq. citric acid (2×50 mL), water (10×50 mL), brine, and dried (Na₂SO₄). Solvent was removed under vacuum, and the crude product was washed with hexanes (4×20 mL) and dried. Yellow crystals.¹H NMR (400 MHz): 7.74 (m, 1H); 3.73 (t, J=6.0 Hz, 4H); 2.66 (t, J=6.0 Hz, 4H). MS (m/z): 275 [M+H].

Intermediate 18. Triethylamine (TEA; 5.6 mL, 43.87 mmol) was added to the Intermediate 17 (8.1 g, 29.56 mmol) in THF (120 mL) at 0° C., followed by triisopropylsilyl triflate (TIPSOTf; 10.7 g, 34.97 mmol). The mixture was allowed to warm up to r.t. over ca. 40 min, and stirred for another 2 h. Solvent was removed on a rotary evaporator. EtOAc (180 mL) was added, and the solution washed with 10% aq. NaHCO₃ (40 mL), brine (60 mL) and dried (Na₂SO₄). Solvent was removed under vacuum and to afford the product as a red-brownish oil. This was directly used at the next step without purification.

Intermediate 19. Ceric ammonium nitrate (CAN, 19.0 g, 34.65 mmol) was added portionwise with stirring to a solution of the Intermediate 18 (12.4 g, 28.80 mmol) in dry DMF (100 mL) at 0° C. The reaction mixture was allowed to warm up to r.t. and stirred for another 4 h. Most of solvent was removed under vacuum. Water (ca. 75 mL) was added and the mixture was extracted with EtOAc (2×100 mL). The combined organic layers were washed with brine and dried (Na₂SO₄). Solvent was removed and the residue purified by column chromatography (gradient 20% to 30% EtOAc in petroleum ether). The product was obtained as a yellow solid. ¹H NMR (400 MHz): 7.84 (m, 1H); 7.14 (m, 1H); 5.43 (d, J=8.2 Hz, 1H); 4.06 (t, J=7.2 Hz, 2H); 2.74 (t, J=7.2 Hz, 2H). MS (m/z): 273 [M+H].

Intermediate 20. NH₄Cl (0.33 g, 6.2 mmol) in water (5 mL) was added to a hot solution of the Intermediate 19 (0.170 g, 0.62 mmol) in EtOH (10 mL). Iron powder (0.173 g, 3.1 mmol) was added portionwise with stirring, and the mixture at ca. 100-105° C. for 50 min. The solution was filtered, and the precipitate washed with EtOH (5×10 mL). EtOH was removed under vacuum, and residue distributed between EtOAc (ca. 50 mL) and water (10 mL). Aq. layer was washed with EtOAc (3×20 mL), and combined organic layers were washed with water (3×7 mL), brine, and dried (MgSO₄). Solvent was removed under vacuum to afford the product as yellow crystals. ¹H NMR (400 MHz): 7.03 (m, 1H); 6.36 (m, 1H); 5.19 (d, J=8.0 Hz, 1H); 4.12 (d, J=7.2 Hz, 2H); 3.80 (t, J=7.2 Hz, 2H); 2.66 (t, J=7.2 Hz, 2H). MS (m/z): 243 [M+H].

Intermediate 21.60% NaH in mineral oil (1.4 g, 36.0 mmol) was added portionwise with stirring to the Intermediate 20 (2.9 g, 11.94 mmol) in THF (20 mL) at 0° C. under Ar, and the mixture was stirred at this temperature for 30 min. Benzyl chloroformate (4.1 g, 24.03 mmol) was added dropwise with stirring. The reaction mixture was allowed to warm up to r.t. and stirred o.n. The reaction was carefully quenched with water (10 mL), and THF was removed under vacuum. The residue was taken in DCM (80 mL). Organic layer was washed with brine (50 mL) and dried (Na₂SO₄). Solvent was removed under vacuum, and the residue dissolved with MeOH (40 mL). Aq. NH₃ (25 mL) was added with stirring, and the mixture was stirred at r.t. for 2 h. Solvent was removed under vacuum, and EtOAc (100 mL) was added. The organic layer was washed with brine and dried (Na₂SO₄). Solvent was removed under vacuum, and the residue purified by column chromatography (gradient 25% to 100% DCM/petroleum ether). White solid. ¹H NMR (400 MHz): 7.95 (m, 1H); 7.41 (m, 6H); 7.07 (m, 2H); 5.28 (s, 2H); 3.88 (t, J=7.6 Hz, 2H); 2.69 (t, J=7.6 Hz, 2H). MS (m/z): 377 [M+H].

Compound of Example 1. 1.06M Lithium hexamethyldisilylamide (LHMDS; 3.0 mL, 3.18 mmol) in THF was added dropwise with stirring to a solution of the Intermediate 21 (1.0 g, 2.66 mmol) in THF (8.0 mL) at −78° C., and the mixture was stirred at this temperature for 30 min. (R)-Glycidyl butyrate (0.8 mL, 5.55 mmol) was added dropwise, and the mixture was allowed to warm up to r.t. and stirred o.n. The reaction was quenched with 10% aq. NH₄Cl (15 mL), and THF was removed under vacuum. The residue was extracted with EtOAc (2×30 mL). Combined organic layers were washed with brine and dried (Na₂SO₄). Solvent was removed under vacuum. MeOH (5 mL) and 20% aqueous Cs₂CO₃ (5 mL) were added, and the mixture was stirred at r.t. for 20 min. The mixture was taken into EtOAc (50 mL), washed with water (2×15 mL), brine, and dried (Na₂SO₄). Solvent was removed under vacuum and the crude product was purified by column chromatography (2% methanol/DCM). Off-white solid. ¹H NMR (400 MHz): 7.44 (m, 1H); 7.10 (d, J=7.6 Hz, 1H); 5.33 (d, J=8.0 Hz, 1H); 4.84 (m, 1H); 4.19 (m, 1H); 4.08 (m, 2H); 3.92 (t, J=7.4 Hz, 2H); 3.81 (dd, J=12.4, 3.2 Hz, 1H); 2.71 (t, J=7.4 Hz, 2H); 2.14 (br, 1H). MS (m/z): 343 [M+H].

………………………………..

WO2010091272A1

http://www.google.com/patents/WO2010091272A1?cl=en

Scheme 4 below.

Scheme 4. Example for synthesis of (isoxazole-3-yl)amino compounds of formula I.

a) Piperidin-4-one hydrochloride, DIEA, NMP, -5 ⁰C to r.t; b) TMSOTf,

TEA, THF, 0 ⁰C to r.t.; c) O-allyl-0′ -methyl carbonate, Pd(OAc)₂, DMSO, 2,3,4,5-tetrafluoronitrobenzene, 60 ⁰C; d) Fe, NH₄Cl, EtOH, 95 ⁰C; e) isobutyl chloroformate, Py, DCM, 0 ⁰C to r.t.; f) two steps: 1) (Λ)-glycidyl butyrate or chlorohydrine, Bu¹OLi, THF, MeCN, 0-30 ⁰C; 2) 10% aq. K₂CO₃; g) MsCl, TEA, THF, 0 ⁰C; h) 3-[N-(/er/-butoxycarbonyl)amino]isoxazole, Bu¹OK, DMF, 20-40 ⁰C; i) aq. HCl, EtOH, EtOAc, 0 ⁰C to r.t.

Select innovative steps pertaining to the particular utility of Scheme 4 for an efficient synthesis and production of the compounds of formula I (illustrated by structure 26 in the Scheme 4) are summarized in paragraphs (i-iv) below:

i) The novel efficient method for an installation of the dihydropyridone ring into an ortho-F compound of formula I provided herein involve the use of an alkoxide (e.g, methoxide) capture reagent (e.g., 2,3,4,5-tetrafluoronitrobenzene). The dihydropyri done-forming step for a transformation of the compounds 19 to compounds 20 performed in absence of the methoxide-capture reagent(s) is accompanied by formation of the hard-to-remove ort/zo-methoxy impurity (e.g., l-(2,6-difluoro-3-methoxy-4-nitrophenyl)-2,3-dihydropyridone) resulted from undesired substitution of ortho-F atom with MeOH, AIkOH, or anion thereof. This is a serious problem specific for the synthesis of ortho-F dihydropyridone compounds, arising from the unique reactivity of ortho-F substrates 19 and may not be encountered in synthesis of des-ortho-F compounds lacking the key ortho-F substitution. The methods disclosed herein involve the use of a methoxide-capture nitrobenzene additive to eliminate or minimize above methoxy-aryl by-product to allow for a high-yielding preparation and manufacture of precursors 19 and compounds of formula I, with a purity suitable for pharmaceutical applications (generally, better than 90-95%). Additional MeO-capture additives may include acylating, alkylating, or arylating agents (e.g., carboxylic acid anhydride or an active ester capable of methoxide acylation). Optionally, one or more alkoxide-capture reagent(s), or a combination thereof can be used.

ii) New practical method for the key oxazolidinone-forming step (from

22 to 23) provided herin involves the use of an alkali metal alkoxide (e.g., LiOBu- 1) instead of the conventionally used BuLi (as more generally described, e.g., in J. Med. Chem., 1988, vol. 41, pp. 3727-3735). The procedure provided herein thus eliminates the use of a highly flammable and unstable organometallic chemical. Moreover, the new processes provided herein also eliminates the need for costly cryogenic (-78 ⁰C) conditions impractical for the industrial manufacture of the reagents 23 and of the compounds of formula I. [00111] iii) Novel process for the preparation of 5-[(isoxazole-3-yl)amino]methyl derivatives 25 that employs an alkali metal alkoxide ( e.g., KOBu-t) in place of previously used NaH (as more generally described, e.g., in International Patent Publication No. WO 00/21960, incorporated herein by reference in its entirety). This eliminates the use of an extremely flammable base and allows for an efficient preparation and manufacture of the precursors 25 and the compounds of formula I.

iv) New practical method for the synthesis of the compounds of formula I

(Ri = (isoxazole-3-yl)amino; structure 26 in Scheme 4) employing aq. HCl – organic solvent(s) system for deprotection of acid-cleavable protective groups (PG; e.g., PG = tert-butoxycarbonyl or Boc group). The method provided herein eliminates the use of highly toxic and expensive reagents conventionally employed for des-ortho-F 1-phenyldihydropyridone compounds (the method as described, for example, in International Patent Publication No. WO 2004/033449, advocating the use of trifluoroacetic acid and 1 ,2-dichloroethane Boc-deprotection system). The efficiency of the new deprotection method invented herein is particularly surprising in view of the fact that enamino ketones (such as dihydropyridones) are generally degradable by a strong aqueous acids, such as aq. HCl (as more generally described, e.g., by Katritzky et al. in J. Chem. Research, Miniprint, 1980, pp. 3337-3360).

……………………………….

US8178683

https://www.google.com/patents/US8178683

Example 5 Compound of Structure

Scheme for Compound of Example 5

Intermediate 25.

Method A. A solution of tert-butyl isoxazol-3-ylcarbamate (187 mg, 1.00 mmol) in DMF (1 mL) was added dropwise with stirring to a suspension of NaH (60% in mineral oil, 48 mg, 1.20 mmol) in DMF (2 mL). The mixture was stirred under N₂ for 15 min. at 35° C. The Intermediate 22 (357 mg, 0.85 mmol) in DMF (1 mL) was added, and the mixture was stirred at 50° C. for 1.5 h. The reaction mixture was taken into EtOAc (30 mL), washed with 10% aq. NH₄Cl (2×15 mL), brine, and dried (Na₂SO₄). Solvent was removed under vacuum and the crude material was purified by column chromatography (2% MeOH/DCM) to afford the product as a light yellow solid.

Method B. A solution of tert-butyl isoxazol-3-ylcarbamate (694 mg, 3.8 mmol) in DMF (3 mL) was added dropwise with stirring to Bu^tOK (439 mg, 3.8 mmol) in DMF (3 mL) at 0° C. The mixture was warmed up to r.t. and stirred for 30 min. The Intermediate 22 (1.34 g, 3.2 mmol) in DMF (6 mL) mL) was added, and the mixture was stirred at 35° C. for 2 h. The reaction was quenched with saturated aq. NH₄Cl solution (10 mL), and isolation performed just as described above for Method A to afford the product as a light yellow solid. ¹H NMR (400 MHz): 8.28 (s, 1H), 7.44 (m, 1H), 7.09 (d, J=7.6 Hz, 1H), 7.00 (s, 1H, 5.32 (d, J=7.6 Hz, 1H), 5.15 (m, 1H), 4.44 (m, 1H), 4.20 (m, 2H, 3.94 (m, 3H), 2.70 (t, J=7.4 Hz, 2H), 1.45 (s, 9H). MS (m/z): 509 [M+H].

Compound of Example 5

Method A. TFA (2.0 mL) was added dropwise to the solution of the Intermediate 25 (310 mg, 0.61 mmol) in 1,2-dichloroethane (DCE; 2 mL) at 0° C., and the solution was stirred at 0° C. for 30 min. Volatiles were removed under vacuum, and the residue taken into EtOAc (30 mL). The solution was washed with saturated NaHCO₃ solution (2×15 mL), brine, and dried (Na₂SO₄). Solvent was removed under vacuum and the crude product was purified by column chromatography (3% MeOH/DCM). Light-yellow solid.

Method B. 4M HCl in THF (56 mL) was added dropwise to the Intermediate 25 (3.0 g, 5.9 mmol) at 0° C. Water (0.59 mL) was added, and the solution was stirred at r.t. for 2 h. Most of volatiles were removed under vacuum, the residue taken into water (30 mL) and sat. aq. NaHCO₃ (15 mL), and pH adjusted to ca. 8. After stirring for 15 min, the mixture was extracted with EtOAc (3×60 mL). Combined organic layers were washed with brine (2×30 mL), and dried (Na₂SO₄). Solvent was removed under vacuum. The residue was re-dissolved in 2% MeOH in DCM (3 mL), and passed through a short pad of silica, eluting the product with 2% MeOH in DCM. Light-yellow solid. ¹H NMR (400 MHz, DMSO-d₆): 8.41 (d, J=1.6 Hz, 1H); 7.57 (m, 1H), 7.50 (d, J=8.0 Hz, 1H), 6.58 (t, J=5.8 Hz, 1H), 6.02 (d, J=1.6 Hz, 1H), 5.08 (d, J=8.0 Hz, 1H), 4.90 (m, 1H), 4.17 (t, J=8.6 Hz, 1H), 3.86 (m, 3H), 3.48 (t, J=5.6 Hz, 2H), 2.49 (m, overlapped with DMSO-d₆, 2H). MS (m/z): 409 [M+H].

pick up int 22

from below

Example 3 Compound of Structure

Scheme for Compound of Example 3

Intermediate 22. Methylsulfonyl chloride (MsCl; 79 uL, 1.00 mmol) was added dropwise with stirring to the compound of Example 1 (290 mg, 0.85 mmol) and TEA (177 uL, 1.27 mmol, 1.50 equiv.) in DCM (5 mL) at ca. 0° C. The mixture was stirred for 20 min and allowed to warm up to r.t. The reaction mixture distributed between water and the DCM. Aq. layer was extracted with DCM (2×10 mL), and the combined organic layers washed with brine and dried (Na₂SO₄). Solvent was removed under vacuum to afford the product that was used for the next step without purification.

Intermediate 23. A mixture of the Intermediate 22 (567 mg, 1.35 mmol) and NaN₃ (438 mg, 6.75 mmol) in DMF (5 mL) was stirred at 55° C. o.n. After cooling to r.t., water (15 mL) was added, and the reaction mixture was extracted with DCM (3×30 mL). Combined organic layers were washed with brine (30 ml) and dried (Na₂SO₄). Solvent was removed under vacuum to afford the product as a light yellow solid. This was used directly for the next step without further purification.

Compound of Example 3. A mixture of the Intermediate 23 (785 mg, 2.14 mmol) and bicyclo[2.2.1]hepta-2,5-diene (2.2 mL, 21.4 mmol) in 1,4-dioxane (22 mL) under N₂ was heated at 100° C. for 3 h. Most of volatiles were removed under vacuum, and the residue was purified by column chromatography (1% MeOH/DCM). Thus isolated product was recrystallized from MeOH. White solid. ¹H NMR (400 MHz): 7.83 (s, 2H), 7.05 (m, 2H), 5.30 (d, J=8 Hz, 1H), 5.16 (m, 1H), 4.83 (d, J=3.6 Hz, 2H), 4.33 (m, 1H), 4.06 (m, 1H), 3.91 (t, J=14.8 Hz, 2H), 2.69 (t, J=14.8 Hz, 2H). MS (m/z): 394 [M+H].

1. MicuRx Pharmaceuticalsresistant Gram-positive bacteria, Inc. MicuRx and Shanghai Zhangjiang biomedical industry venture capital partner to develop next-generation antibiotic MRX-I for Chinese market. Available online: http://www.micurx.com/doc/10-24-12%20JV-FINAL.doc (accessed on 11 April 2013).
2. MicuRx Pharmaceuticals. Discovery and development. Available online: http://www.micurx.com/d1.htm(accessed on 12 December 2012).
3. CN 102206213
4. CN 102485224
5.  CN 102485225

Graphical Abstract

Highlights

► This review presents anti-tuberculosis compounds currently in clinical trials. ► Promising strategies in preclinical development are described. ► The chemical synthesis, target and mechanism of action are highlighted. ► Activities observed in preclinical and clinical studies are reported.

Tuberculosis is a major disease causing every year 1.8 million deaths worldwide and represents the leading cause of mortality resulting from a bacterial infection. Introduction in the 60′s of first-line drug regimen resulted in the control of the disease and TB was perceived as defeating. However, since the progression of HIV leading to co-infection with AIDS and the emergence of drug resistant strains, the need of new anti-tuberculosis drugs was not overstated. However in the past 40 years any new molecule did succeed in reaching the market. Today, the pipeline of potential new treatments has been fulfilled with several compounds in clinical trials or preclinical development with promising activities against sensitive and resistant Mycobacterium tuberculosis strains. Compounds as gatifloxacin, moxifloxacin, metronidazole or linezolid already used against other bacterial infections are currently evaluated in clinical phases 2 or 3 for treating tuberculosis. In addition, analogues of known TB drugs (PA-824, OPC-67683, PNU-100480, AZD5847, SQ609, SQ109, DC-159a) and new chemical entities (TMC207, BTZ043, DNB1, BDM31343) are under development. In this review, we report the chemical synthesis, mode of action when known, in vitro and in vivo activities and clinical data of all current small molecules targeting tuberculosis.

Eur J Med Chem. 2012 May;51:1-16. doi: 10.1016/j.ejmech.2012.02.033. Epub 2012 Feb 25.

Villemagne, B.; Crauste, C.; Flipo, M.; Baulard, A.R.; Déprez, B.; Willand, N. Tuberculosis: Villemagne, B.; Crauste, C.; Flipo, M.; Baulard, A.R.; Déprez, B.; Willand, N. Tuberculosis: The drug development pipeline at a glance. . Eur. J. Med. Chem. 2012, 51, 1–16, doi:10.1016/j.ejmech.2012.02.033.

EPEREZOLID

pfizer.originator

 CAS NO  165800-04-4 

(S)-N-[[3-[3-Fluoro-4-[4-(2-hydroxyacetyl)piperazin-1-yl]phenyl]-2-oxo-1,3-oxazolidin-5-yl]methyl]acetamide

(S)-N-[[3-[3-fluoro-4-[4-(hydroxyacetyl)-l-piperazinyl]- phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide

Oxazolidinones are a new class of Gram-positive antibacterial agents which are known to those skilled in the art, see for example US 5,688,792. (S)-N-[[3-[3- fluoro-4-(4-morpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide, known as linezolid, the compound of Example 5 of US Patent 5,688,792 is known and has the following chemical formula:

(S)-N-[[3-[3-fluoro-4-[4-(hydroxyacetyl)-l-piperazinyl]-phenyl]-2-oxo-5- oxazolidinyl]methyl]acetamide, known as eperezolid, the compound of

Example 8 of US Patent 5,837,870 is known and has the following chemical formula:

Linezolid and eperezolid can be produced by the processes set forth in US Patents 5,688,791 and 5,837,870 as well as that of International Publication WO99/24393. It is preferably produced by the process of US Patent 5,837,870.

It is preferred that the linezolid produced be used in crystal form π, which has the characteristics set forth in CHART A. Once linezolid is synthesized, crystal Form π is prepared by starting with linezolid of high enantiomeric purity. It is preferred that the linezolid be more than 98% enantiomerically pure, it is more preferred that the linezolid be more than 99% pure and it is even more preferred that the linezolid be 99.5% pure. The linezolid of greater than 98% enantiomeric purity to be used to form crystal form II can either be in solution or be a solid. The linezolid starting material, solid or solution, is mixed with a solvent selected from the group consisting of compounds of the formula: water, acetonitrile, chloroform, methylene chloride, R OH where R_\ is Cι-C₆ alkyl; Rι-CO-R₂ where R₂ is Cι-C alkyl and Ri is as defined above; phenyl substituted with 1 thru 3 Ri where Ri is as defined above; Rι-CO-O-R₂ where Ri is -C alkyl and Ri is as defined above; Rι-O-R₂ where

is Cι-C₆ alkyl and Ri is as defined above. It is preferred that the solvent be selected from the group consisting of water, ethyl acetate, methanol, ethanol, propanol, isopropanol, butanol, acetonitrile, acetone, methyl ethyl ketone, chloroform, methylene chloride, toluene, xylene, diethyl ether, or methyl-t-butyl ether. It is more preferred that the solvent be ethyl acetate, acetone, acetonitrile, propanol, or isopropanol. It is most preferred that the solvent be ethyl acetate. The mixture of linezolid in the solvent is agitated at a temperature below 80° until crystals of Form II are formed and crystals of other solid forms, such as Form I, disappear. It is preferred to dissolve the linezolid in ethyl acetate at a temperature near the boiling point of the solvent. This mixture is cooled to a temperature of about 70°. The mixture may be seeded with crystals of Form II to facilitate crystallization. It is preferred that the solid product is cooled and agitated at a temperature between about 45° and about 60° until the solids consist only of Form II crystals. It is most preferred to maintain the slurry at a temperature of about 55°. It is preferred to mix the linezolid and solvent for at least 10 min, it is even more preferred to mix the linezolid and solvent for at least 20 min and it is most preferred to mix the linezolid and solvent for at least 30 min. The time and temperature will vary depending on the solvent selected. With ethyl acetate it is preferred to mix for not less that 60 minutes. The crystalline slurry may be further cooled to improve yield, and the solid Form II product may be isolated. The mixture may be further cooled and agitated. Other measures which can be used to facilitate crystallization include, but are not limited to, cooling, concentration of the solution by evaporation or distillation, or through addition of other solvents. The crystals are isolated by procedures known to those skilled in the art.

It is well known to those skilled in the art that the oxazolidinones are useful as anti-bacterial agents especially against Gram-positive organisms. US Patent 5,688,792 discloses that oxazolidinones can be administered IV. The preferred formulation for linezolid IV solution is: Linezolid 2.0 mg mL

Sodium Citrate Dihydrate (USP) 1.64 mg/mL

Citric Acid Anhydrous (USP) 0.85 mg/mL

Dextrose Monohydrate (USP) 50.24 mg/mL

Hydrochloric Acid ( 10%) q.s. to pH 4.8 (pH 4.6 to 5.0) Sodium hydroxide (10%) q.s. to pH 4.8 (pH 4.6 to 5.0)

Water for Injection (USP) q.s. ad 1.0 mL

The linezolid IV solution is formulated by heating water for injection from about 50 to about 65°. Next the sodium citrate, citric acid and dextrose are added and stirred until dissolved. An aqueous slurry of linezolid is added to the previous mixture and stirred until dissolved. The mixture is cooled to 25° with stirring. The pH is measured and adjusted if necessary. Last the mixture is brought to volume, if necessary, with water for injection. The mixture is filtered, filled into infusion containers, over wrapped and terminally moist heat sterilized.

The aqueous solution for IV administration can be placed in the container which is selected from the group consisting of a bag, a bottle, a vial, a large volume parenteral, a small volume parenteral, a prefilled syringe and a cassette. It is realized that a vial is a bottle. However, those skilled in the art use the term “bottle” to refers to larger bottles and “vials” to refer to smaller bottles. It is preferred that the container be a bag, a bottle, a vial or a prefilled syringe. It is more preferred that the container be a bag or bottle. It is most preferred that the container be a bag. The shape and/or size of the container is unimportant. It is preferred that the container be a bag sufficient to hold 25 to 2,000 mL of IV solution. It is preferred that the linezolid mixture be put in bags in amounts of 100, 200 or 300 mL of solution however smaller or larger volumes are acceptable.

……………..

http://www.google.com/patents/WO2007138381A2?cl=en

. Scheme 2. Synthesis of eperezolid

RR==IH-

s

Et₃N,

17 (eperezolid)

1-(2-Fluoro-4-nitrophenyl)piperazine (8). To 3,4-difluoronitrobenzene (20.5 g, 129 mmol) in acetonitrile (290 mL) was added triethylamine (36 mL) and piperazine (32 g, 387 mmol). The mixture was stirred at reflux for 18 h, after which it was cooled to room temperature and partitioned between H₂O (500 mL) and EtOAc (400 mL). The layers were separated and the aqueous layer was extracted with EtOAc (2 x 300 mL). The organic layers were combined and washed with saturated NaCI solution (400 mL). The saturated NaCI layer was extracted again with EtOAc (2 x 200 mL). The organic layers were combined, dried over Na₂SO₄, filtered and concentrated to yield 8 as a yellow solid (29 g, quant.). ¹H NMR (400 MHz, CDCI₃) δ 1.63 (s, 1 H), 3.04-3.06 (m, 4H), 3.25-3.28 (m, 4H), 6.91 (t, J=8.7, 1 H), 7.90 (dd, J=13.2, 2.5, 1 H), 7.97- 8.00 (m, 1H).

3-Fluoro-4-(piperazin-1-yl)benzenamine (9). Compound 8 (10.0 g, 44.4 mmol) was dissolved in anhydrous EtOH (222 mL) and placed in a Parr pressure flask. PtO₂ catalyst (31 mg) was added and the mixture was agitated under 50-60 psi of H₂ on a Parr apparatus for 30 min, after which the reaction mixture was vented, more catalyst was added (78 mg) and the reaction mixture was submitted to 50-60 psi of H₂ for another 30 min. The reaction mixture was filtered on Celite, the solid was washed with MeOH₁ and the combined filtrates were concentrated to give 9 as a yellow solid (8.7 g, quant.). ¹H NMR (400 MHz, CDCI₃) δ 1.64 (bs,

1 H), 2.92-2.94 (m, 4H), 3.02-3.04 (m, 4H), 5.53 (bs, 2H)₁ 6.38-6.45 (m, 2H), 6.80 (t, J=8.5, 1 H).

Benzyl 4-(4-((benzyloxy)carbonyl)piperazin-1 -yl)-3-fluorophenylcarbamate (10).

Compound 10 was obtained in 78% yield (light yellow solid) using the protocol described in J. Med. Chem. 1996, 39, 673-679. ¹H NMR (400 MHz, CDCI₃) δ 2.98 (bs, 4H), 3.65-3.68 (m, 4H),

5.16 (s, 2H), 5.19 (s, 2H), 6.59 (bs, 1H), 6.85 (t, J=9.1 , 1 H), 6.94-6.97 (m, 1 H), 7.27-7.41 (m,

11H).

Benzyl 4-(2-fluoro-4-((R)-5-(hydroxymethyl)-2-oxo-oxazolidin-3-yl)phenyl) piperazine-1-carboxylate (11). Compound 11 was obtained in 66% yield (off-white solid) using the protocol described in J. Med. Chem. 1996, 39, 673-679. ¹H NMR (400 MHz, CDCI₃) δ 3.01

(bs, 4H), 3.66-3.69 (m, 4H), 3.74-3.79 (m, 1H)₁ 3.92-4.03 (m, 3H), 4.71-4.77 (m, 1H), 5.16 (s,

2H), 6.91 (t, J=9.1 , 1 H), 7.11-7.14 (m, 1H), 7.91-7.38 (m, 5H), 7.46 (dd, J=14.2, 2.5, 1 H).

Benzyl 4-(2-fluoro-4-((/?)-5-(methanesulfonyloxymethyl)-2-oxo-oxazolidin-3- yl)phenyl) piperazine-1-carboxylate (12). Compound 12 was obtained in quantitative yield (off- white foam) using the protocol described in J. Med. Chem. 1996, 39, 673-679. ¹H NMR (400 MHz, CDCI₃) δ 3.02 (bs, 4H), 3.10 (s, 3H), 3.67-3.69 (m, 4H), 3.92 (dd, J=9.1 , 6.1 , 1 H), 4.12 (t, J=QA, 1H), 4.44 (dd, J=11.7, 3.8, 1H), 4.49 (dd, J=11.7, 3.8, 1H), 4.88-4.94 (m, 1H), 5.16 (s, 2H), 6.93 (t, J=9.1 , 1 H), 7.08-7.12 (m, 1 H), 7.30-7.38 (m, 5H), 7.44 (dd, J=14.0, 2.6, 1 H).

Benzyl 4-(4-((S)-5-(aminomethyl)-2-oxo-oxazolidin-3-y!)-2-fluorophenyl) piperazine- 1-carboxylate (13). Compound 13 was obtained in 70% yield from 12 (4.4 g, 8:67 mmol), following the same procedure as for compound 6. After work-up, crude 13 was purified by flash chromatography using a gradient of 0-2-5-10% MeOH / CHCI₃ as eluent. ¹H NMR (400 MHz,

CDCI₃) δ 1.33 (bs, 2H), 2.94-3.03 (m, 5H), 3.11 (dd, J=13.7, 4.1 , 1 H), 3.66-3.69 (m, 4H)₁ 3.82

(dd, J=8.6, 6.7, 1 H), 4.00 (t, J=8.7, 1 H)₁4.63-4.69 (m, 1 H), 5.16 (s, 2H), 6.91 (t, J=9.1 , 1 H)₁7.12- 7.15 (m, 1 H)₁ 7.30-7.38 (m, 5H)₁ 7.47 (dd, J=14.3, 2.6, 1 H).

Benzyl 4-(4-((S)-5-(acetylaminomethyl)-2-oxo-oxazolidin-3-yl)-2-fluorophenyl) piperazine-1-carboxylate (14). Compound 14 was obtained in 90% yield from 13 (5.3 g, 12.4 mmol), following the same procedure as for compound 7. After work-up, the compound was used without any further purification. ¹H NMR (400 MHz, CDCI₃) δ 2.02 (s, 3H), 3.01 (bs, 4H), 3.57-3.77 (m, 7H)₁4.01 (t, J=9.0, 1 H)₁4.73-4.79 (m, 1 H)₁ 5.16 (s, 2H)₁6.05 (t, J=6.2, 1H)₁6.91 (t, J=9.2, 1H), 7.05-7.08(m, 1 H)₁ 7.32-7.38 (m, 5H)₁ 7.44 (dd, J=14.2, 2.62, 1 H).

Λ/-[((S)-3-(3-fluoro-4-(piperazin-1-yl)phenyl]-2-oxo-oxazolidin-5-yl)methyl)acetamide (15). To a solution of 14 (748 mg, 1.59 mmol) in abs. ethanol (40 ml.) was added cyclohexene (1 ml.) and 10% Pd / C (400 mg). The mixture was refluxed for 2 h, when TLC indicated complete reaction. The reaction mixture was filtered through celite and concentrated to give 15 as an off-white solid (520 mg, 97%). The product was essentially pure, but could be purified by chromatography (90:10:1.5 CH₂CI₂:MeOH:conc. NH₄OH). ¹H NMR (400 MHz, CDCI₃) 52.01 (s, 3H), 3.02 (d, J=Al, 8H), 3.57-3.76 (m, 3H), 4.01 (t, J=9.0, 1H), 4.73-4.79 (m, 1H), 6.29 (m, 1H)₁ 6.92 (t, J=9.1 , 1 H), 7.04-7.07(m, 1 H), 7.39-7.43 (m, 1 H).

Λ/-(((S)-3-(4-(4-(2-(benzyloxy)acetyl)piperazin-1-yl)-3-fluorophenyl)-2-oxooxazolidin- 5-yl)methyl)acetamide (16). To a solution of 15 (537 mg, 1.60 mmol) and triethylamine (0.22 mL, 3.53 mmol) in CH₂CI₂ (35 mL) at 0 ⁰C was added benzyloxyacetyl chloride (0.30 ml_, 1.92 mmol). The mixture was stirred at 0 ⁰C for 1 h, then 15 min at room temperature when TLC indicated complete reaction. The reaction mixture was washed with water (2 x 30 mL), and saturated sodium bicarbonate (2 x 30 mL), and dried over MgSO₄. After chromatography (gradient elution 5-10% MeOH / CH₂CI₂) the product was obtained as a white foam (709 mg, 91%). ¹H NMR (400 MHz, CDCI₃) δ 2.02 (s, 3H), 2.98-3.14 (m, 4H), 3.56-3.86 (m, 7H), 4.02 (t, J=9.0, 1 H), 4.22 (S, 2H), 4.62 (s, 2H), 4.73-4.80 (m, 1H)₁ 6.02 (t, J=5.9,1 H), 6.96-7.10 (m, 2H), 7.28-7.40 (m, 5H), 7.45-7.53 (m, 1 H).

Λ/-(((S)-3-(3-fluoro-4-(4-(2-hydroxyacetyl)piperazin-1-yl)phenyl)-2-oxooxazoiidin-5- yl)methyl)acetamide (17, eperezolid). To a solution of 16 (709 mg, 1.46 mmol) in abs. ethanol (40 mL) was added cyclohexene (1 mL) and 10% Pd / C (250 mg). The mixture was refluxed for 15 h, when TLC indicated complete reaction. The reaction mixture was filtered through Celite™ and concentrated to give 17 (470 mg, 82% yield). The product was essentially pure, but could be purified by chromatography. ¹H NMR (400 MHz, CDCI₃) δ 2.02 (s, 3H), 3.06-3.10 (m, 4H), 3.45-3.50 (m, 2H), 3.58-3.77 (m, 3H), 3.85-3.87 (m, 2H), 4.02 (t, J=9.0, 1 H), 4.21 (s, 2H), 4.74- 4.80 (m, 1H), 6.09 (t, J=6.0, 1 H), 6.97 (t, J=QA , 1 H), 7.07-7.10 (m, 1 H), 7.46-7.50 (m, 1 H). LCMS : 96.1% (254 nm), 95.1% (220 nm), 94.5% (320 nm). MS : 395 (MH)⁺.

……………….

http://www.google.com/patents/WO1997037980A1

EXAMPLE 8 (S)-N-[[3-[3-fluoro-4- 4-(hydro3ζyacetyl)-l-piperazinyl]-phenyl]-2- oxo-5-oxazoHdinyl]methylJ-acetamide sesquihydrate (VIII) To a stirred mixture of (S)-N-[[3-[3-fluoro-4-(l-piperazinyl)phenyl]-2-oxo-5- oxazoHdinyl]methyl]acetamide hydrochloride (EXAMPLE 7, 16.2 kg, 43.5 moles), tetrahydrofuran (205 kg) and triethylamine (10.1 kg, 100 moles) is added acetoxyacetyl chloride (6.5 kg, 47.8 moles) in tetrahydrofuran (11.1 kg) over 35 minutes keeping the temperature at 22-23°. After 40 minutes, at which time TLC and HPLC analysis indicated complete formation of the acetoxyacetamide intermediate, the mixture is concentrated under reduced pressure to 30 1, diluted with methanol (100 1) and concentrated to 30 1. To the residue is added methanol (25 1) and an aqueous solution of potassium carbonate (5.6 kg in 56 1). The resulting mixture is stirred 20 hr at 22-25° at which time TLC and HPLC analysis indicates the reaction is complete. The pH is adjusted to 7-7.5 with hydrochloric acid (4 N, 14.3 1). The mixture is stirred 18 hr at 15-22° then 3 hrs at 2-5°. The soHds are collected on a filter, washed with water (68 1) and dried at 20-25° with recycled nitrogen to give the desired product. The crude product is dissolved in water (225 1) at 60-70°, clarified through a 0.6 micron filter, diluted with water rinse (55 1) and stirred 17 hrs. at 15°. The solids are collected on a filter, washed with water at 15° and dried at 45° with recycled nitrogen to a water content of 0.33%. These soHds are dissolved in a solution of ethyl acetate (143 1), methanol (65 1) and water (1.95 1) at 60-65°. The solution is cooled to 15-25° and stirred 16 hrs for crystallization. The soHds are coUected on a filter, washed with ethyl acetate (75 1) and dried with 45° nitrogen to give the desired product. The product is recrystallized two more times from water (147 1 then 133 1) at 60-70°, clarified each time through a 0.6 micron filter and rinsed with water (40 1 and 30 1). The soHds are dried on the filter at 30° with recycled nitrogen to give, after deagglomeration through a mill, the title compound as the sesquihydrate (6.45% water), TLC (siHca gel; methanol/methylene chloride, 5/95) Rf = 0.45; [α]_D = -20° (c = 1.0, ethanol).

pamidronate eperezolid

Sutezolid

168828-58-8

N-({(5S)-3-[3-fluoro-4-(thiomorpholin-4-yl)phenyl]-2-oxo-oxazolidin-5-yl}methyl) acetamide

(S)—N-[[3-[3-fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide

Sutezolid (PNU-100480, PF-02341272) is an oxazolidinone antibiotic currently in development as a treatment for extensively drug-resistant tuberculosis.

Rapid evaluation in whole blood culture of regimens for XDR-TB containing PNU-100480 (sutezolid), TMC207, PA-824, SQ109, and pyrazinamide

Sutezolid, an antimicrobial oxazolidinone and the thiomorpholine analogue of linezolid, had been in early clinical development for the treatment of tuberculosis. However, development was discontinued.

The compound had been found to be active against Gram-positive bacteria such as multiresistant staphylococci, streptococci and enterococci. It was being developed by Pfizer. In 2011, orphan drug designation was assigned in the U.S. and the E.U. for the treatment of tuberculosis.

In 2013, Sequella acquired an exclusive worldwide license for the development and commercialization of sustezolid.

http://www.google.com/patents/US20110190199

Scheme 1 illustrates a general synthetic sequence for preparing compounds of the present invention.

Example 3 Preparation of (5S)-5-{[(4-chlorobenzylidene)amino]methyl}-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-1,3-oxazolidin-2-one

The title compound in Example 2 (194 g, 0.56 mole), and the title compound of Example 1 (195 g, 0.84 mole), and lithium tert-butoxide (116 g, 1.4 mole) were charged into a 3000 mL three neck round bottom flask under nitrogen. The reactants were slurried with methyl tert-butyl ether (1200 mL) and the mixture was warmed to 56° C. and stirred for 2 h as a yellow solid gradually formed. The reaction was cooled to room temperature, and diluted with 1200 mL water. The mixture was then stirred vigorously over 60 min as the solid changed from dark yellow to a more pale yellow solid. The mixture was cooled to 10° C., filtered, and the filter cake was washed with ice cold methyl tert-butyl ether (450 mL). The resulting light yellow solid was dried in air for 30 min, then placed in a vacuum oven and dried at 40° C. overnight to afford the title compound (243 g, 99% yield). ¹H NMR (400 MHz, CDCl₃): δ 2.8 (m, 4H), 3.2 (m, 4H), 3.9 (m, 2H), 4.1 (m, 2H), 5.0 (m, 1H), 6.9 (m, 1H), 7.2 (m, 1H), 7.4 (m, 3H), 7.6 (m, 2H), 8.4 (s, 1H).

Example 4 Preparation of N-{[(5S)-3-(3-fluoro-4-thiomorpholin-4-ylphenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide

The title compound in Example 3 (243 g, 0.56 mole) was combined with EtOAc (1300 mL) and water (1300 mL) in a 5000 mL three neck round bottom flask equipped with a mechanical stirrer. The mixture was treated drop-wise with 12N HCl (140 mL, 1.68 moles) and the mixture was stirred vigorously for 1 hour at room temperature. The layers were separated and the aqueous layer was washed with EtOAc (1×500 mL). The resulting aqueous solution containing (S)-5-(aminomethyl)-3-(3-fluoro-4-thiomorpholinophenyl)oxazolidin-2-one hydrochloride was combined with a mixture of dichloromethane (1800 mL) and MeOH (120 mL), and the vigorously stirred mixture was charged with acetic anhydride (132 mL, 1.4 mole) in one portion and subsequently treated drop-wise with 10 N NaOH (200 mL, 2.0 mole) over 15 min. An extremely thick reaction mixture resulted from addition of the base, which gradually thinned as the pH rose and the acylation rapidly progressed. The reaction was stirred vigorously for 1 hour after the mixture resolved to two phases. At that time, 10 M NaOH (160 mL, 1.6 mole) was added drop-wise to the mixture until the pH was stable at 7. The layers were separated, the aqueous layer was extracted with dichloromethane (250 mL), and the combined organic layers were dried over anhydrous potassium carbonate. The volatiles were removed in vacuo to give an off-white solid which was titrated with methyl tert-butyl ether (250 mL), collected, and dried in vacuo to give title compound (5) (186.1 g, 94% yield) as a fine white solid with greater than 98% HPLC purity (retention time=3.93 minutes, HPLC conditions reported below).

The crude solid was dissolved in warm 6% methanol in dichloromethane (1250 mL) in a 5000 mL three neck round bottom flask equipped with a mechanical stirrer. The solution was warmed to reflux, diluted by the portion-wise (500 mL) addition of 2500 mL isopropanol (IPA), and, in order to maintain reflux, the temperature was ramped to 50-70° C. On completion of this addition of IPA, the reflux condenser was replaced with a short-path distillation head and distillation was continued into a cooled flask. During distillation, a 500 mL portion of fresh IPA was added after 500 mL of distillate was collected to maintain between 2000 and 2500 mL IPA present at all times. After this addition (internal flask temperature dropped to 60° C.) the mixture became slightly cloudy and remained so for the balance of the distillation, becoming increasingly cloudy as the distillate temperature exceeded 70° C.; particulate matter appeared as the distillate temperature exceeded 75° C. The temperature controller was ramped to 85° C. and held there until the conclusion of the distillation. When the distillate was clearly isopropanol alone (82-83° C.) the volume was reduced to 2500 mL hot IPA, the heating mantle was removed, stirring was discontinued, and the paddle was removed from the flask. The mixture was allowed to continue to crystallize as the flask cooled. The white crystalline solid was then collected by filtration, washed with methyl tert-butyl ether (250 mL), and dried in vacuo at 40° C. to afford 180 g (91% yield) of the title compound in greater than 99% HPLC purity (retention time=3.93 minutes, HPLC conditions reported below). ¹H NMR (400 MHz, DMSO-d₆): δ 1.8 (s, 3H), 2.7 (m, 4H), 3.2 (m, 4H), 3.4 (m, 2H), 3.7 (m, 1H), 4.7 (m, 1H), 7.1 (m, 1H), 7.15 (m, 1H), 7.2 (m, 1H), 8.2 (m, 1H). Mass Spec. C₁₆H₂₀FN₃O₃S: m/z 354.1 (M+1).

HPLC conditions for analyses mentioned in the text: HP Series 1100; Column: Symmetry C8 5 uM 4.6×50 mm; Flow rate 1.2 mL/min; Solvent A: water with 0.1% formic acid, Solvent B: acetonitrile with 0.1% formic acid; Injection volume=10 uL of 1 mg/mL (acetonitrile); Gradient: Solvent B 0-100% over 7 minutes then 100% B for 1 minute; wavelength=254 nm.

Identification of a novel oxazolidinone (U-100480) with potent antimycobacterial activity
J Med Chem 1996, 39(3): 680

http://pubs.acs.org/doi/full/10.1021/jm950956y

(S)-N-[[3-[3-Fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl]acetamide (6, U-100480). A solution of (R)-[3-[3-fluoro-4-(4-thiomorpholinyl)phenyl]-2-oxo-5-oxazolidinyl]methyl azide (19.662 g, 58.28 mmol) in dry THF (290 mL) was treated with triphenylphosphine (16.815 g, 64.11 mmol) over 10 min. After 2.0 h, TLC analysis (10% MeOH/CHCl₃) revealed the conversion to iminophosphorane was complete. H₂O (2.10 mL, 116.56 mmol) was added and the reaction mixture heated to 40 °C (internal temperature) for 5 h and then allowed to cool to ambient temperature overnight. At this point, TLC analysis (10% MeOH/CHCl₃) indicated incomplete hydrolysis of the iminophosphorane intermediate. More H₂O (8.40 mL) was added, and the reaction was heated to 40 °C for 5 h. At this time, TLC indicated complete conversion to the 5-(aminomethyl)oxazolidinone intermediate. The reaction mixture was first concentrated by rotary evaporation (benzene was added several times to azeotrope off the H₂O) and then under high vacuum to give the crude amine as an off-white solid. This material was dissolved in CH₂Cl₂ (250 mL), treated with pyridine (46.099 g, 47.10 mL, 582.79 mmol) and acetic anhydride (29.749 g, 27.49 mL, 291.40 mmol), and then stirred overnight at ambient temperature. TLC analysis (10% MeOH/CHCl₃) showed complete conversion to 6. The reaction mixture was diluted with CH₂Cl₂, transferred to a separatory funnel, and then washed with 1 N HCl until the washings were acidic. The organic layer was then washed with saturated aqueous NaHCO₃ and brine, dried over Na₂SO₄, filtered, and concentrated in vacuo to give crude 6 (U-100480) as a cream-colored solid. The crude product was triturated with hot CHCl₃; most but not all of the solids dissolved. After cooling to ambient temperature, the solids were filtered off (cold CHCl₃ wash) and dried in vacuo to furnish 13.174 g of analytically pure title compound as a white solid. A second crop of 3.478 g, also analytically pure, afforded a combined yield of 81%:

mp 186.5−187.0 ^oC; [α]_D −8° (c 1.00, CHCl₃);

IR (mull) 1749, 1746, 1641, 1656, 1518, 1448, 1419, 1225, 1215, 1158, 1106, 1083, 867 cm^-1;

 ¹H NMR (300 MHz, CDCl₃) δ 7.42 (dd, 1H, J = 2.6, 14.0 Hz), 7.06 (ddd, 1H, J = 1.0, 2.6, 8.8 Hz), 6.95 (dd, 1H, J = 9.0, 9.0 Hz), 6.61 (br t, 1H, J = 6.0 Hz), 4.81−4.72 (m, 1H), 4.02 (dd, 1H, J = 9.0, 9.0 Hz), 3.75 (dd, 1H, J = 6.7, 9.1 Hz), 3.71−3.55 (m, 2H), 3.32−3.27 (m, 4H), 2.84−2.79 (m, 4H), 2.02 (s, 3H);

MS m/z (rel intensity) 353 (M⁺, 100), 309 (31), 279 (5), 250 (17), 235 (14), 225 (20), 212 (7), 176 (19), 138 (18), 42 (28);

HRMS calcd for C₁₆H₂₀N₃O₃FS 353.1209, found 353.1200. Anal. (C₁₆H₂₀N₃O₃FS) C, H, N.

see aLSO

WO 1995007271

WO 2010026526

Repurposed drugs for tuberculosis treatment.

http://www.nature.com/nrd/journal/v12/n5/fig_tab/nrd4001_F1.html

Ranbezolid

392659-39-1 hydrochloride

392659-38-0 (free base)

N-{[(5S)-3-(3-Fluoro-4-{4-[(5-nitro-2-furyl)methyl]-1-piperazinyl}phenyl)-2-oxo-1,3-oxazolidin-5-yl]methyl}acetamide

(S)-N-[[3-fluoro-4-[N-1[4-{2-furyl-(5-nitro)methyl}]piperazinyl]-phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamide

Ranbezolid is a novel oxazolidinone antibacterial. It competitively inhibits monoamine oxidase-A (MAO-A).^[1]

Infections due to Gram-positive bacteria such as methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant Enterococcus faecium (VRE), and penicillin-resistant Streptococcus pneumoniae(PRSP) are the leading cause of morbidity and mortality in hospital settings and community today. Oxazolidinones are a new class of totally synthetic antibacterial agents active against Gram-positive infections. Linezolid  (Zyvox™, Pharmacia/Pfizer,  is a drug in this class, approved in the United States and Europe for treatment of Gram-positive nosocomial and community-acquired pneumoniae and skin infections. Oxazolidinones inhibit the bacterial protein synthesis prior to the chain initiation step, by binding to the 23S rRNA of 50S ribosomal subunit, and interfering with the initiator fMet–tRNA binding to the P-site of the ribosomal peptidyltransferase centre

Ranbezolid hydrochloride, RBx-7644

The title compound is prepared by reductive alkylation of the known piperazinyl oxazolidinone derivative (I) with 5-nitro-2-furfural (II) in the presence of NaBH(OAc)3, followed by conversion to the corresponding hydrochloride salt.

EP 1303511; US 2002103186; WO 0206278; WO 0307870; WO 0308389

…………….

synthesis

The antibacterial activity of RBx-7644 is due to the 5(S)-acetamidomethyl configuration at the oxazolidinone ring, and thus, asymmetric synthesis of only the 5(S)-enantiomer was desirable: 3,4-Difluoronitrobenzene (I) is condensed with piperazine in acetonitrile to give 4-(2-fluoro-4-nitrophenyl)-piperazine (II) as a light yellow compound. Compound (II) is dissolved in dichloromethane and triethylamine, followed by the addition of Boc-anhydride, to provide compound (III). 4-(tert-Butoxycarbonyl)-1-(2-fluoro-4-nitrophenyl)piperazine (III), upon hydrogenation with H2 over Pd/C in methanol at 50 psi, yields 4-(tert-butoxycarbonyl)-1-(2-fluoro-4-aminophenyl)piperazine (IV) as a dark solid. Compound (IV) reacts with benzylchloroformate in dry THF in the presence of solid sodium bicarbonate to afford the desired compound (V). 4-(tert-Butoxycarbonyl)-1-[2-fluoro-4-(benzyloxycarbonylamino)phenyl]piperazine (V), upon treatment with n-BuLi and (R)-glycidyl butyrate at -78 癈, gives the desired (R)-(-)-3-[3-fluoro-4-[4-(tert-butoxycarbonyl)piperazin-1-yl]phenyl]-5-(hydroxymethyl)-2-oxazolidinone (VI). The hydroxymethyl compound (VI) is treated with methanesulfonyl chloride in dichloromethane in the presence of triethylamine to give (R)-(-)-3-[3-fluoro-4-[4-(tert-butoxycarbonyl)piperazin-1-yl]phenyl]-5-(methylsulfonyloxymethyl)-2-oxazolidinone (VII). The sulfonyl derivative (VII) is treated with sodium azide in dimethylformamide to provide the azide (VIII) as a white solid. (R)-(-)-3-[3-Fluoro-4-[4-(tert-butoxycarbonyl)piperazin-1-yl)phenyl]-5-(azidomethyl)-2-oxazolidinone (VIII), upon hydrogenation with H2 over Pd/C at 45 psi, gives (S)-(-)-3-[3-fluoro-4-[4-(tert-butoxycarbonyl)-piperazin-1-yl]phenyl]-5-(aminomethyl)-2-oxazolidinone (IX). The aminomethyl compound (IX), upon treatment with acetic anhydride in dichloromethane in the presence of triethylamine, affords the acetamide derivative (X). The acetamidomethyl-oxazolidinone derivative (X), upon treatment with trifluoroacetic acid, gives (S)-(-)-3-[3-fluoro-4-(1-piperazinyl)phenyl]-5-(acetamidomethyl)-2-oxazolidinone, which, without isolation, is treated with 5-nitro-2-furaldehyde in the presence of sodium triacetoxy borohydride to provide compound (XI). Compound (XI), upon treatment with ethanolic HCl, affords RBx-7644 as a light yellow crystalline solid.

………………….

polymorphs

http://www.google.com/patents/US20050209248

(S)-N-[[3-fluoro-4-[N-1[4-{2-furyl-(5-nitro)methyl}]piperazinyl]-phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamidehydrochloride having the Formula I.

The compound of Formula I, namely, (S)-N-[[3-fluoro-4-[N-1 [4-{2-furyl-(5-nitro)methyl}] piperazinyl]-phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamide hydrochloride is a phenyl oxazolidinone derivative, as disclosed in PCT application WO 02/06278. It is said to be useful as antimicrobial agent, effective against a number of human and veterinary pathogens, including gram-positive aerobic bacteria, such as multiply resistant staphylococci, streptococci and enterococci as well as anaerobic organisms such as Bacterioides spp. andClostridia spp. species, and acid fast organisms such as Mycobacterium tuberculosis, Mycobacterium avium and Mycobacterium spp.

The PCT application WO 02/06278 describes the preparation of compounds of Formula I. The products of Formula I obtained by following the cited methods tend to be hygroscopic and difficult to filter. These types of disadvantageous properties have proven to be serious obstacles to the large-scale manufacture of a compound. Further, handling problems are encountered during the preparation of pharmaceutical compositions comprising the hygroscopic compound of Formula I obtained by following the method disclosed in WO 02/06278.

EXAMPLE 1 Preparation of Polymorphic ‘Form A’ of the Compound of Formula I

50 gm of free base of Formula I was dissolved in ethanol (750 ml) by heating at about 60° C. and to this solution was added ethanolic HCl (13.36 ml, 8.9 N) at about 45-50° C. The reaction mixture was cooled to about 10° C., and stirred for about 4 hours. The separated solid was filtered off and dried under vacuum at 60° C. The solid was then digested in ethanol (150 ml) at 70-80° C. for about 4 hours. It was then cooled to about 10° C., the solid was filtered and dried under vacuum at 60-65° C. to give 30 gm of the pure polymorphic ‘Form A’ of compound of Formula I.

………………

Synthesis and SAR of novel oxazolidinones: Discovery of ranbezolid
Bioorg Med Chem Lett 2005, 15(19): 4261

http://www.sciencedirect.com/science/article/pii/S0960894X05008310

Graphical abstract

Novel oxazolidinones were synthesized containing a number of substituted five-membered heterocycles attached to the ‘piperazinyl–phenyl–oxazolidinone’ core of eperezolid. Further, the piperazine ring of the core was replaced by other diamino-heterocycles. These modifications led to several compounds with potent activity against a spectrum of resistant and susceptible Gram-positive organisms, along with the identification of ranbezolid (RBx 7644) as a clinical candidate.

Substitution of five-membered heterocycles on to the ‘piperazinyl–phenyl–oxazolidinone’ core structure led to the identification of ranbezolid as a clinical candidate. Further replacement of piperazine ring with other diamino-heterocycles led to compounds with potent antibacterial activity.

• Synthesis of compound 7: (S)-N-[[3-[3-Fluoro-4-(N-4-tert-butoxycarbonyl-piperazin-1-yl)phenyl]-2-oxo-5-oxa-zolidinyl]-methyl]acetamide (28a, 3.65 kg, 8.37 mol) was dissolved in dichloromethane (30.86 L) and cooled to 5 °C. To it trifluoroacetic acid (6.17 L) added dropwise and stirred for 14 h allowing the reaction mixture to warm to rt. The reaction mixture was evaporated in vacuo and the residue dissolved in tetrahydrofuran (58 L) followed by addition of molecular sieves 4 Å (4.2 kg). To the resulting mixture 5-nitro-2-furaldehyde (1.5 kg, 10.77 mol) was added followed by sodium triacetoxyborohydride (5.32 kg, 25.1 mol) and stirred for 14 h. The reaction mixture was filtered over Celite and filtrate evaporated in vacuo. The residue was dissolved in ethylacetate (85.6 L) and washed with satd sodium bicarbonate solution (36 L) and water (36 L). The organic layer was dried over anhyd sodium sulfate (3 kg) and evaporated in vacuo. The crude residue was purified by column chromatography (1–3% methanol in ethylacetate) to obtain (S)-N-[[3-[3-fluoro-4-[N-4-(5-nitro-2-furylmethyl)-piperazin-1-yl]phenyl]-2-oxo-5-oxa-zolidinyl]methyl]acetamide (39, 2.6 kg, yield 67%). Mp: 136 °C. ¹H NMR (CDCl₃): δ 7.42 (dd, 1H, phenyl–H), 7.29 (m, 2H, furyl–H), 7.07 (d, 1H, phenyl–H), 6.92 (t, 1H, phenyl–H), 6.51 (d, 1H, furyl–H), 6.11 (t, 1H, –NHCO–), 4.77 (m, 1H, oxazolidinone ring C₅–H), 4.01 (t, 1H), 3.85–3.45 (m, 5H), 3.09 (m, 4H, piperazine–H), 2.72 (m, 4H, piperazine–H), 2.02 (s, 3H, –COCH₃). MS m/z (rel. int.): 462.1 [(M+H)⁺, 100%], 484 [(M+Na)⁺, 25%], 500.2 [(M+K)⁺, 20%]. HPLC purity: 98%.

• Compound 39(3.6 kg, 7.81 mol) was dissolved in abs ethanol (53.8 L) by heating to 60 °C. The resulting solution was cooled to 45 °C and ethanolic hydrochloride (1.48 L, 7.9 N) was added dropwise in 10 min. The mixture was then cooled to 10 °C and stirred for 4 h and the precipitate formed was filtered and washed with ethanol and dried to obtain (S)-N-[[3-[3-fluoro-4-[N-4-(5-nitro-2-furylmethyl)-piperazin-1-yl]phenyl]-2-oxo-5-oxazolidinyl]-methyl]acetamide hydrochloride, ranbezolid (7, 3.2 kg, yield from 39: 82%, yield from 28a: 55%).

• Ranbezolid

• Mp: 207–209 °C.

•  ¹H NMR (DMSO, 300 MHz): δ 8.30 (t, 1H, –NHCO–), 7.75 (d, J = 3.3 Hz, 1H, furyl–H), 7.52 (dd, 1H, phenyl–H), 7.3–7.0 (m, 3H, phenyl–H, furyl–H), 4.70 (m, 1H, oxazolidinone ring C₅–H), 4.63 (s, 2H), 4.08 (t, J = 8.8 Hz, 1H, –CH₂–), 3.73 (t, J = 7.5 Hz, 1H), 3.43 (br m, piperazine–H merged with H₂O in DMSO), 1.83 (s, 3H, –COCH₃).

• HPLC purity: 98%. Anal. Calcd for C₂₁H₂₅ClN₅O₆·0.5H₂O: C, 50.76; H, 5.48; N, 14.09. Anal. Found: C, 50.83; H, 5.17; N, 13.83.

References

BC-7013 (topical)

[14-O-[(3-Hydroxymethyl-phenylsulfanyl)-acetyl]-mutilin]

Pleuromutilins

Nabriva

Gram-positive

poster……….https://jmilabs.com/data/posters/ICAAC2009/F1-1521.pdf

BC-7013 [14-O-[(3-Hydroxymethyl-phenylsulfanyl)-acetyl]-mutilin] is a novel semi-synthetic pleuromutilin derivative that inhibits prokaryotic protein synthesis.

Pleuromutilins were discovered as natural-product antibiotics in 1950. Tiamulin was the first pleuromutilin compound to be approved for veterinary use in 1979, followed by valnemulin in 1999. It was not until 2007 that retapamulin became the first pleuromutilin approved for use in humans. However, retapamulin is limited to topical application. Recent advances in lead optimization have led to the synthesis of pleuromutilins that combine potent antibacterial activity with favorable pharmaceutical properties, making these compounds suitable for oral and intravenous delivery. Most pleuromutilins have an antibacterial spectrum that spans the common pathogens involved in both skin and respiratory tract infections. Two new pleuromutilins, BC-3205 and BC-7013 (both Nabriva Therapeutics AG), have entered clinical trials. In this review, the key properties of pleuromutilin derivatives, designed primarily through modifications at the C(14) side chain, are presented, and the potential of these compounds in systemic therapy in humans is discussed.

Discovered in 1959, pleuromutilins have the potential to be developed as a new class of antibiotics for systemic use in humans. Although in 2007 retapamulin became the first pleuromutilin approved for topical use in humans, it was not until 2011 that a pleuromutilin antibiotic, BC‑3781, was tested successfully in a Phase 2 clinical trial for systemic use in patients.

BC‑7013 belongs to a series of proprietary Nabriva pleuromutilins, which have been designed by Nabriva’s medicinal chemists to fulfill the specific requirements of a topical antibacterial agent. The clinical study is designed to evaluate safety and tolerability of BC‑7013.

In recent years, bacterial infections resistant to most forms of current antibiotics have appeared throughout the world and are currently the third leading cause of death in the US and Western Europe. Pleuromutilins represent a new class of antibiotics, inhibiting bacterial protein synthesis by binding to unique sites on the 50S subunit of the ribosome. These new antibiotics have two distinct advantages: they have a very low potential for cross-resistance with other established antibacterial classes and display a very low potential for resistance development.

“This is the second pleuromutilin antibiotic Nabriva has moved into clinical trials since our inception 18 months ago, emphasising our view of the potential of this new antibiotic class”, said Rodger Novak, Chief Operating Officer of Nabriva.

Nabriva’s first pleuromutilin program to enter the clinic, BC‑3205, is an oral agent with activity against gram positive and gram negative bacteria and atypicals. BC‑3205 is currently in a multi-dose Phase 1 trial.

Pleuromutilin antibiotics are a novel clinically validated class of antibiotics that specifically inhibit bacterial protein synthesis. Their antibacterial profile covers resistant pathogens, including MRSA, that cause diseases such as respiratory tract and skin infections.

Nabriva Therapeutics’ pleuromutilins are unique antimicrobial compounds that interfere with bacterial protein synthesis via a specific interaction with the 23S rRNA of the 50S bacterial ribosome subunit. These antibacterials have a distinct anti-bacterial profile. Their unique mechanism of action implies a very low probability of cross resistance with other antibacterials. In an industry first, Nabriva’s world class medicinal chemistry expertise achieved the development of intravenous and orally available pleuromutilins clearing the way for i.v. and oral therapy with this antibiotic class. This achievement constitutes a significant milestone in providing appropriate medication for the treatment of life-threatening bacterial infections offering a distinctly different class of antibiotics for the treatment of bacterial diseases.

• New class of antibiotics on the human market
• High target specificity plus a unique mode of action ensures differentiation from existing antibiotic classes and compounds in development
• Very low propensity for resistance development
• Accessibility to both Gram-positive & Gram-negative ribosomes translates into broad spectrum activity against a wide range of infections
• Excellent safety profile
• Oral, intraveneous and topical delivery

Nabriva is the first company with proof of concept achieved for the systemic use of pleuromutilins in patients. Two new pleuromutilins, BC‑3781 and BC‑7013, from Nabriva have shown excellent results in clinical studies. BC‑3781 is about to enter Phase 3. Since Nabriva´s pleuromutilin antibiotics have an ideal anti-bacterial spectrum for both skin and respiratory infections and are available as both oral and i.v. formulations, they address a significant medical need and constitute an excellent commercial opportunity.

mutilins

Mutilin is minor metabolite of the pleuromutilin family, originally isolated from Pleurotus mutilus. Mutilin is formed by hydrolysis of the hydroxyacetyl ester of pleuromutilin, and is a degradation product and in vivo metabolite of

pleuromutilin. Interest in mutilin has focused on its potential as a substrate for generating unique metabolites via
biosynthesis to provide a broader range of targets for semi-synthetic modification.

pleuromutilin

Nabriva. Pleuromutilins. Available online: http://www.nabriva.com/programs/pleuromutilins/ (accessed on 7 December 2012).

Novak, R. Are pleuromutilin antibiotics finally fit for human use? Ann. NY Acad. Sci. 2011, 1241, 71–81, doi:10.1111/j.1749-6632.2011.06219.x.

Valnemulin

101312-92-9,

launched 1999 novartis for bacterial infection

Valnemulin (trade name Econor) is a pleuromutilin antibiotic used to treat swine dysentery, ileitis, colitis and pneumonia. It is also used for the prevention of intestinal infections of swine.^[1] Valnemulin has been observed to induce a rapid reduction of clinical symptoms ofMycoplasma bovis infection, and eliminate M. bovis from the lungs of calves.^[2]

Pleuromutilin, a compound of formula

is a naturally occurring antibiotic, e.g. produced by the basidomycetes Pleurotus mutilus and P. passeckerianus, see e.g. The Merck Index, 12th edition, item 7694.

A number of further pleuromutilins having the principle ring structure of pleuromutilin and having e.g. antibacterial activity, have been developed.

A pleuromutilin of the present invention includes a pleuromutilin having the basic structural elements as set out in formula

wherein R is vinyl or ethyl and the dotted line is a bond or is no bond.

The following numbering system is used in the present application:

The dotted line between positions 19 and 20 (and between positions 1 and 2) is a bond or is no bond. In a compound of formula A or of formula PLEU a hydrogen atom in positions 4, 7 and/or 8 of the ring system may be replaced by deuterium, and if the dotted line between positions 1 and 2 is no bond (single bond between positions 1 and 2) the ring system may be further substituted in positions 1 and/or 2, e.g. by halogen, deuterium or hydroxy. The group —O— in position 14 is further substituted, preferably by a substituted carbonyl group.

Examples of pleuromutilins according to the present invention includes e.g.

• • A compound as disclosed in U.S. Pat. No. 3,716,579, e.g. of formula

• wherein R is CH₃—(CH₂)₇—CH═CH—(CH₂)₇—COO—, CH₃—(CH₂)₄—CH═CH—CH₂—CH═CH—(CH₂)₇—COO—, CH₃—(CH₂)₉—CH═CH—(CH₂)₇—COO— or hydrogen;
  • A compound as disclosed in GB1312148, e.g. of formula

14-Desoxy-14[(2-diethylaminoethyl)mercaptoacetoxy]mutilin, e.g. also known as tiamulin of formula 

 

• • A compound as disclosed in U.S. Pat. No. 4,130,709, e.g. of formula

 

• • A compound as disclosed in U.S. Pat. No. 4,129,721; e.g. of formula

and the 19,20-dihydro derivative thereof and the tetra(C_2-6)alkanoyl derivatives thereof;

• • A compound as disclosed in EP0013768, e.g. of formula

• • A compound as disclosed in EP0153277, e.g. an N-acyl-14-O-[(1-amino-2-methylpropan-2-yl)thioacetyl]-mutilin or 19,20-dihydromutilin, such as of formula

wherein R₁ is vinyl or ethyl positions 19 and 20), and R₂ is optionally hydroxy-substituted aminoalkyl or a 5-membered saturated heterocycle, e.g. including Valnemulin (Econor®) of formula

• • A compound as disclosed in U.S. Pat. No. 516,526, e.g. of formula

wherein R₁ and R₂ independently of each other are H, alkyl, alkenyl, cycloalkyl, aryl or aralkyl;

• • A compound as disclosed in WO9322288, e.g. of formula

wherein R₁ and R₂ are independently of each other H, alkyl, or, R₁ and R₂ together with the carbon atom to which they are attached are cycloalkyl; and R₃ and R₄ independently of each other are H, alkyl or substituted alkyl;

• • A compound as disclosed in WO9725309, e.g. of formula

wherein Y is carbamoyloxy, wherein the N-atom is unsubstituted or mono- or disubstituted, such as a compound of formula

see more at……..

• • A compound as disclosed in EP0153277, e.g. an N-acyl-14-O-[(1-amino-2-methylpropan-2-yl)thioacetyl]-mutilin or 19,20-dihydromutilin, such as of formula

wherein R₁ is vinyl or ethyl positions 19 and 20), and R₂ is optionally hydroxy-substituted aminoalkyl or a 5-membered saturated heterocycle, e.g. including Valnemulin (Econor®) of formula

• • A compound as disclosed in U.S. Pat. No. 516,526, e.g. of formula

wherein R₁ and R₂ independently of each other are H, alkyl, alkenyl, cycloalkyl, aryl or aralkyl;

• • A compound as disclosed in WO9322288, e.g. of formula

wherein R₁ and R₂ are independently of each other H, alkyl, or, R₁ and R₂ together with the carbon atom to which they are attached are cycloalkyl; and R₃ and R₄ independently of each other are H, alkyl or substituted alkyl;

• • A compound as disclosed in WO9725309, e.g. of formula

wherein Y is carbamoyloxy, wherein the N-atom is unsubstituted or mono- or disubstituted, such as a compound of formula

see more at…………….http://www.google.com/patents/US8088823

• Valnemulin is known from EP-0.153.277 and is described specifically therein in example 12.
  Valnemulin is also known by the commercial name Econor®.
• As is generally known, this compound has antibacterial properties, e.g. following oral or parenteral administration, and is used for the prevention or cure of a series of bacterial infections in the field of animal health. The broad spectrum of activity includes Streptococcus aronson, Staphylococcus aureus, Mycoplasma arthritidis, Mycoplasma bovigenitalium, Mycoplasma bovimastitidis, Mycoplasma bovirhinis,Mycoplasma sp., Mycoplasma canis, Mycoplasma felis, Mycoplasma fermentans, Mycoplasma gallinarum, Mycoplasma gallisepticum, A. granularum, Mycoplasma hominis, Mycoplasma hyorhinis,Actinobacillus laidlawii, Mycoplasma meleagridis, Mycoplasma neurolyticum, Mycoplasma pneumonia und Mycoplasma hyopneumoniae.
• WO 98/01127 describes its excellent activity against an illness complex that can arise whenever animals are kept in a very restricted space (increased stocking density) e.g. for transport purposes, and are thus exposed to great stress. The most frequent pathogens that play a decisive role in this instance are Mycoplasma hyopneumoniae, Serpulina(formerly Treponema) hyodysenteriae, Serpulina pilosicoli, Lawsonia intracellularis, Mycoplasma gallisepticum, Pasteurella multocida, Actinobacillus (Haemophilus) pleuropneumoniae and Haemophilus parasuis, whereby diseases of the respiratory tract and other infections often occur together and lead to a complex clinical picture. All herd animals are affected, e.g. cattle, sheep and pigs, but also poultry.
• In its free form (valnemulin base), valnemulin is relatively unstable and is therefore primarily used in the form of its salts, particularly as the hydrochloride. A current method of administering antibiotics in the field of animal health is the injection, since it is suitable for administering a controlled single dose and thus a quantity tailored to individual needs. This is often crucial to successful control of many infectious diseases in the field of animal medicines. In contrast, oral administration cannot be controlled nearly so well, and is more customary in human medicine.
• However, it has been shown that aqueous injection solutions and even oily injection suspensions of the salts of valnemulin are poorly tolerated by most domestic animals and in particular by pigs. Damage ranging from mild skin irritation to poorly healing necroses, has been observed. This is also one of the reasons that valnemulin has mainly been used orally until now. In addition, aqueous solutions usually do not show the desired depot action. A further problem is that valnemulin cannot be produced in technical quantities in the free form, as the so-called valnemulin base, but occurs as the salt, and has therefore been used for therapy as the salt.

………………………………….

syn

http://www.google.com/patents/CN102675173B?cl=en

valnemulin hydrochloride (Valnemulin hydrochloride) chemical name: [[2_ [[(2R) _2_ amino-3 - methyl-1 - oxobutyl] amino] -1,1 – dimethyl- ethyl] thio] acetic acid (3aS, 4R, 5S, 6S, 8R, 9R, 9aR, I OR) -6 – vinyl-decahydro-5 – hydroxy -4,6,9,10 – tetramethyl-1 – oxo _3a, 9 – propanol _3aH_ cyclopenta cyclooctene en-8 – yl ester hydrochloride, the chemical structure of formula I as shown. A molecular weight of 601.28, as a white amorphous powder characters have strong hygroscopicity, soluble in water, ethanol, methyl tert-butyl ether in almost insoluble, mp 174-177Ό.

Valnemulin hydrochloride is a new generation of pleuromutilins semi-synthetic antibiotics, are two terpenes, and tiamulin belong to the same class of drugs that are animal-specific antibiotics. Mainly used for prevention and treatment of pigs, cattle, sheep and poultry mycoplasma disease and Gram-positive bacterial infections. 1999 by the European Commission approved for the prevention and treatment of swine dysentery swine dysentery infection caused by the spirochete short and swine enzootic pneumonia caused by the Mycoplasma pneumoniae infection is the first Europe-wide approval of veterinary drugs premixes, is as a veterinary prescription drugs. September 9, 2010, approved by the Ministry of Agriculture Bulletin No. 1457 of Valnemulin hydrochloride developed materials and premixes for the state Department of Agriculture approved new animal drug II. Therefore, in our veterinary clinic has broad application prospects.

 Chemical synthesis of hydrochloric Valnemulin has a lot of literature. Most of which are to pleuromutilins as raw material, p-toluenesulfonyl chloride sulfonation reaction with dimethyl cysteamine hydrochloride, and then protected with an amino group, a carboxyl group is activated D-valine reaction, the final hydrolysis Valnemulin hydrochloride.

Chinese patent discloses a method for preparing CN102225905A Valnemulin hydrochloride method, which is after the Pleuromutilin reacted with tosyl chloride, after 1 – amino-2 – methyl-2 – thiolate substituted acid to give (2 – amino-1 ,1 – dimethylethyl) thio] acetic acid (3aS, 4R, 5S, 6S, 8R, 9R, 9aR, 10R) -6 – vinyl decahydro _5_ hydroxy -4,6,9,10 – tetramethyl-1 – oxo-3a, 9 – propanol _3aH_ cyclopenta cyclooctene – (4H) -8 spare ester; other with D- valine methyl acetoacetate and the reaction with chloroacetic acid anhydride as isobutyl, and then with (2 – amino-1 ,1 – dimethylethyl) thio] acetic acid (3aS, 4R, 5S, 6S, 8R , 9R, 9aR, I OR) -6 – vinyl decahydro-5 – hydroxy -4,6,9,10 – tetramethyl _1_ oxo _3a, 9 – propanol _3aH_ garrison diene ring and cyclooctene – (4H) -8 ester amide hydrochloride later deprotected valnemulin hydrochloride was obtained, with ether as the solvent for this process, morpholine catalyst. In this line, the spent acid to activate Dioxide valine carboxy, increasing the difficulty of activation, and in the last reaction step using ether as the solvent, low-boiling inflammable volatile ether, in the operation increased risk. [0007] Chinese patent CN101318921A also opened a method for preparing Valnemulin, comprising the following steps: (1) preparation of chlorinated Pleuromutilin: to Pleuromutilin as raw materials, the reaction with HCl, convert it to Chloride pleuromutilin; (2) Preparation of N-allyloxycarbonyl group of valine: valine as starting material, which was reacted with allyl chloroformate to obtain N-protected amino group is allyloxycarbonyl group valine; (3) 1,1 – dimethyl-2 – Preparation of (N-allyloxycarbonyl group valinamido) ethanethiol: N-allyloxycarbonyl group of valine obtained acid chloride with oxalyl chloride and _ chloride with 1,1-dimethyl-2 – aminoethanethiol intermediate obtained by reacting 1,1 – dimethyl -2 – (N-allyloxycarbonyl group valinamido) ethanethiol; (4) Preparation of valnemulin of: 1,1 – dimethyl -2 – (N-allyloxycarbonyl group valinamido) reaction with ethanethiol pleuromutilins chloride to obtain an amino protected valnemulin In palladium catalyzed hydrogenation of carbon was going to protect Valnemulin. The disadvantage of this method is the use of a pleuromutilin in the chloride solution of HCl in methanol, increased corrosion of the equipment; allyl protecting group removal in the spent catalyst is palladium on carbon, palladium on carbon is too high and difficult recovery rates , thereby increasing the cost of the final product.

Starting materials Pleuromutilin by higher fungi Basidiomycetes Pleurotus a strain produced by submerged culture mainly against Gram-positive bacteria and mycoplasma active antimicrobial substances. As a semi-synthetic precursor substance, its content and impurities have a significant impact on the synthesis of hydrochloric acid Valnemulin quality standards. Recrystallization can effectively remove impurities and improve the content, thus effectively simplify the purification process to remove impurities and hydrochloric La Vergne wonderful forest to provide a guarantee from the source.

 Example 1:

 A Valnemulin hydrochloride chemical synthesis method, as follows:

 (I) purified pleuromutilin

[0021] 250g of pleuromutilin first dissolved in methyl tert-butyl ether 2000mL stirred solution clear. Activated carbon was then added 50g, stirred for 3 h at room temperature decolorization, activated carbon was filtered off and the filtrate was concentrated to about 500mL heating when a large number of crystal precipitation, heating was stopped, cooled to room temperature and stirring was continued for 4h. After the crystals were centrifuged and dried to obtain fine pleuromutilin 220g (yield 88%).

References

MK 2048

Molecular Formula: C₂₁H₂₁ClFN₅O₄   Molecular Weight: 461.873943

869901-69-9, 3oyl, 3oyn

Merck & Co., Inc.

6(S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide

MK-2048 is a second generation integrase inhibitor, intended to be used against HIV infection. It is superior to the first available integrase inhibitor,raltegravir, in that it inhibits the HIV enzyme integrase 4 times longer. It is being investigated for use as part of pre-exposure prophylaxis (PrEP). ^[1]

It is being developed by Merck & Co.^[2]

MK-2048 is a second generation integrase inhibitor for HIV-1 integrase. MK-2048 inhibits subtype B and subtype C integrase activities. MK-2048 inhibits R263K mutants slightly more effectively than G118R mutants.

MK-2048 inhibits S217H intasome and, by contrast, MK2048 remains fully active against the N224H intasome. MK2048 displays substantially lower dissociation rates compared with raltegravir, another integrase inhibitor.

MK-2048 is active against viruses resistant to RAL and EVG. MK-2048 exposure leads to the selection of G118R as a possible novel resistance mutation after 19 weeks. MK-2048, with continued pressure, subsequently leads to an additional substitution, at position E138K, after 29 weeks, within the IN gene.

Although the G118R mutation alone confers only slight resistance to MK-2048 but not to RAL or EVG, its presence arouses a dramatic reduction in viral replication capacity compared to wild-type NL4-3. E138K both partially restores viral replication capacity and also contributes to increased levels of resistance against MK-2048.

Structure of MK-2048 with important pharmacophore highlighted

…………………..

Synthesis

WO2005110415A1

http://www.google.as/patents/WO2005110415A1?cl=en

EXAMPLE 62 6(S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide

Step 1: te rt-Butyl[( 1 S)-2-(ethylamino)- 1 -methylethyl] carbamate To a cold (0 °C) solution of N-(tø/ -butoxycarbonyl)-L-alanine N’-methoxy-N’- methylamide (15.6 g, 67.2 mmol) in anhydrous THF (150 mL) and diethyl ether (400 mL), solid lithium aluminum hydride (5.1 g, 134.3 mmol) was added portionwise over a period of 30 minutes. The mixture was stirred at room temperature for 3 hours and cooled back to 0 °C. The reaction was treated carefully with an aqueous solution of potassium hydrogen sulfate (250 mL, 1M). The resultant mixture was diluted with diethyl ether.

The organic extract was washed successively with dilute hydrochloric acid, and brine, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to provide the corresponding aldehyde as colorless solid. Without further purification, a cold (0 °C), stirred solution of the intermediate aldehyde (10.7 g, 61.8 mmol) and ethylamine hydrogen chloride (10.1 g, 123.5 mmol) in methanol (72 mL) was treated with sodium triacetoxyborohydride (17.2 g, 80.9 mmol) in one portion. The mixture was allowed to warm up to room temperature.

After stirring at room temperature overnight, the solution was concentrated under vacuum. The residue was partitioned between diethyl ether and cold aqueous sodium hydroxide (1.5 M). The ethereal extract was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to provide the titled compound. lH NMR (400 MHz, CDCI3) δ 4.68 (br s, IH), 3.75 (br t, IH), 2.62 (m, 5 H), 1.13 (d, J = 6.7 Hz, 3H),

1.09 (t, J = 7.0 Hz, 3H). ES MS M+l = 203

Step 2: ført-Butyl { ( 1 S)-2-[(bromoacetyl)ethylamino] – 1 -methylethyl } carbamate To a cold (0 °C) stirred solution of ?ert-butyl[(lS)-2-(ethylamino)-l- methylethyl]carbamate (11.0 g, 54.6 mmol) in a mixture of ethyl acetate (107 mL) and saturated aqueous sodium bicarbonate (65 mL), bromoacetyl bromide (12.1 g, 60.0 mmol) was added portionwise under an atmosphere of nitrogen. The mixture was allowed to warm up to room temperature over a period of 3.5 hours. The organic phase was separated, washed successively with saturated aqueous sodium bicarbonate, and brine. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was concentrated as a solution in toluene under vacuum to afford the title compound. ES MS M+l = 323, 325.

Step 3: fe7 -Butyl (2S)-4-ethyl-2-methyl-5-oxopiperazine-l-carboxylate To a stirred slurry of sodium hydride (1.7 g, 69.8 mmol) in anhydrous THF (800 mL), a solution of tert-butyl{(lS)-2-[(bromoacetyl)ethylamino]-l-methylethyl}carbamate (17.4 g, 53.7 mmol) in anhydrous THF (100 mL) was added dropwise over a period of 1 hour under an atmosphere of nitrogen. The reaction mixture was stirred at room temperature for two hours, cooled in an ice-water bath, and quenched with dropwise addition of aqueous citric acid (80 mL, 1M). The mixture was concentrated under vacuum. The residue was partitioned between chloroform and saturated aqueous sodium bicarbonate. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluting with a gradient of 0-15% acetonitrile in chloroform. Collection and concentration of appropriate fractions provided the title compound. lH NMR (400 MHz, CDCI3) δ 4.46 (br s, IH), 4.24 (d, J = 18.4 Hz, 1 H), 3.78 (d, J = 18.4 Hz, 1 H),

3.64 (dd, J = 12.3, 4.2 Hz, 1 H), 3.54 (heptet, J = 7.1 Hz, 1 H), 3.38 (heptet, J = 7.1 Hz, 1 H), 2.99 (dd, J = 12.3, 1.8 Hz, 1 H), 1.47 (s, 9H), 1.21 (d, J = 6.8 Hz, 3H), 1.14 (t, J = 7.1 Hz, 3H). ES MS M+l = 243.

Step 4: (5S)-l-Ethyl-5-methylpiperazin-2-one hydrochloride Anhydrous hydrogen chloride gas was bubbled into a cold (-20 °C) solution of tert-butyl (2S)-4-ethyl-2-methyl-5-oxopiperazine-l-carboxylate (10.5 g, 43.4 mmol) in ethyl acetate (250 mL) under nitrogen. After the solution was saturated with hydrogen chloride, the reaction mixture was stirred in an ice-water bath for 30 minutes. The product mixture was purged with nitrogen, concentrated under vacuum to provide the title hydrogen chloride salt as pale yellow solid. lH NMR (400 MHz, DMSO-d6) δ 10.00 (br d, 2H), 3.72 (d, J = 16.6 Hz, 1 H), 3.62(d, J = 16.6 Hz, 1 H),

3.49-3.35 (m, 5 H), 3.29 (heptet, /= 7.3 Hz, 1 H), 1.31 (d, / = 6.6 Hz, 3H), 1.05 (t, J = 7.1 Hz, 3H).

Step 5: Ethyl (4S)-2-ethyl-8-hydroxy-4-methyl-l-oxo-l,2,3,4-tetrahydropyrrolo[l,2-a]pyrazin-7- carboxy late Anhydrous ammonia gas was bubbled into a cold (0 °C) solution of (5S)-l-Ethyl-5- methylpiperazin-2-one hydrochloride (5.8 g, 32.3 mmol) in chloroform for 30 minutes. The resultant slurry was filtered and concentrated under vacuum. The residual oil was concentrated as a solution in toluene under vacuum, redissolved in toluene (120 mL) and treated with diethyl ethoxymethylenemalonate (7.0 g, 32.3 mmol) and heated in a sealed flask in an oil bath at 100 °C overnight. The resultant solution was concentrated under vacuum. The residual oil was concentrated as a solution in toluene under vacuum to provide the corresponding diethyl { [(2S)-4-ethyl-2-methyl-5- oxopiperazin-l-yl]methylene}malonate. Without further purification, to a solution of the malonate (10.5 g, 33.5 mmol) in anhydrous THF (330 mL) warmed with an external oil bath at 65 °C under an atmosphere of nitrogen, a solution of lithium bis(trimethylsilyl)amide (35.1 mL, 1 M, 35.1 mmol) was added. The solution was heated at the same temperature for one hour and concentrated under vacuum. The residue was partitioned between dichloromethane and hydrochloric acid (1M). The organic extract was washed with brine, dried over anhydrous magnesium sulfate, filtered, and concentrated under vacuum. The residue was triturated with diethyl ether. The solid precipitated was filtered, washed with diethyl ether to provide the title compound as pale brown solid. lH NMR (400 MHz, CDCI3) δ 8.43 (s, IH), 7.11 (s, IH), 4.32 (q, J = 7.1 Hz, 2H), 4.24 (m, IH), 3.65-

3.35 (m, 4H), 1.51 (d, J = 6.4 Hz, 3H), 1.36 (t, J = 7.0 Hz, 3H), 1.19 (t, J = 7.0 Hz, 3H). ES MS M+l = 267

Step 6: Ethyl (4S)-2-ethyl-8-methoxy-4-methyl-l-oxo-l,2,3,4-tetrahydropyrrolo[l,2-a]pyrazin-7- carboxylate A mixture of ethyl (4S)-2-ethyl-8-hydroxy-4-methyl-l -oxo- 1,2,3, 4-tetrahydropyrrolo[ 1,2- a]pyrazin-7-carboxylate (6.6 g, 24.8 mmol), anhydrous potassium carbonate (13.7 g, 99.1 mmol, 325 mesh), and iodomethane (4.2 g, 29.7 mmol) in anhydrous DMF (123 mL) was stirred at room temperature overnight. The mixture was filtered and concentrated under vacuum. The residue was partitioned between chloroform and dilute hydrochloric acid. The organic extract was washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluting with a gradient of 0-3% methanol in chloroform. Collection and concentration of appropriate fractions provided the title compound. Residual methanol was removed by concentrating from its solution in toluene under vacuum. lH NMR (400 MHz, CDCI3) δ 7.19 (s, IH), 4.29 (q, J = 7.1 Hz, 2 H), 4.24 (m, IH), 4.03 (s, 3H), 3.70-

3.32 (m, 4 H), 1.52 (d, J = 6.6 Hz, 3H), 1.35 (t, J = 7.0 Hz, 3H), 1.19 (t, J = 7.2 Hz, 3H). ES MS M+l = 281

Step 7: Ethyl (4S)-6-bromo-2-ethyl-8-methoxy-4-methyl-l-oxo-l,2,3,4-tetrahydropyrrolo[l,2- a]pyrazin-7-carboxylate To a mixture of ethyl (4S)-2-ethyl-8-(methoxy)-4-methyl-l-oxo-l,2,3,4- tetrahydropyrrolo[l,2- ]pyrazine-7-carboxylate (6.2 g, 22.1 mmol) and sodium bicarbonate (20.0 g, 238.0 mmol) in dichloromethane (500 mL) at 0 °C, a solution of bromine in dichloromethane (24.2 mmol, 0.5 M) was added over a period of 60 minutes. The reaction mixture was stirred at room temperature for 2 h, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluted with ethyl acetate. Collection and concentration of appropriate fractions provided the corresponding bromide. Residual ethyl acetate was removed by concentrating from its solution in benzene under vacuum. lH NMR (400 MHz, CDCI3) δ 4.58 (br m, IH), 4.34 (m, IH), 3.99 (s, 3H), 3.92 (dd, J = 13.0, 4.0 Hz,

IH), 3.67 (heptet, J = 7.1 Hz, 1 H), 3.49 (heptet, J = 7.1 Hz, 1 H), 3.23 (d, J = 13.0 Hz, IH), 1.40 (d, J = 7.1 Hz, 3H), 1.38 (t, 7 = 7.0 Hz, 3H), 1.20 (t, J = 7.0 Hz, 3H). ES MS M+l = 359, 361.

Step 8: Ethyl (4S)-2-ethyl-8-(methoxy)-6-[methoxy(oxo)acetyl]-4-methyl-l-oxo-l,2,3,4- tetrahydropyrrolo[ 1 ,2- ]pyrazine-7-carboxylate To a cold (-78 °C) solution of ethyl (4S)-6-bromo-2-ethyl-8-methoxy-4-methyl-l-oxo- l,2,3,4-tetrahydropyrrolo[l,2-a]pyrazin-7-carboxylate (8.51 g, 23.7 mmol) in anhydrous THF (800 mL) under an atmosphere of dry nitrogen, a solution of n-BuLi in hexane (10.5 mL, 26.3 mmol, 2.5 M) was added. The resultant mixture was stirred at -78 °C for 20 minutes. A solution of dimethyl oxalate (6.4 g, 53.8 mmol; dried from concentration from benzene under vac) in anhydrous THF (30 mL) was added. The reaction mixture was stirred at -78 °C for 1 hour and cannulated into a mixture of aqueous sulfuric acid (240 mL, 2M) and THF (200 mL) maintained between at -5 to -35 °C. The mixture was extracted with ethyl acetate (3 times). The organic extracts were combined, washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluted with 40 to 100% ethyl acetate- hexane gradient. Collection and concentration of appropriate fractions provided the titled compound. lH NMR (400 MHz, CDCI3) δ 5.07 (m, IH), 4.29 (q, J = 7.2 Hz, 2H), 4.00 (s, 3H), 3.99-3.93 (m, IH), 3.89 (s, 3H), 3.74-3.66 (m, IH), 3.53-3.48 (m, IH), 3.23 (dd, J = 1.3, 13.2 Hz, IH), 1.46 (d, J = 6.6 Hz, 3H), 1.36 (t, J = 7.2 Hz, 3H), 1.22 (t, 7= 7.1 Hz, 3H). ES MS M+l = 367

Step 9: (6S)-8-Ethyl-10-methoxy-6-methyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carbohydrazide A mixture of ethyl (4S)-2-ethyl-8-(methoxy)-6-[methoxy(oxo)acetyl]-4-methyl-l-oxo- l,2,3,4-tetrahydropyrrolo[l,2-α]pyrazine-7-carboxylate (3.3 g, 8.9 mmol) and anhydrous hydrazine (1.7 mL, 53.7 mmol) in methanol (400 mL) was stirred at room temperature for one hour. The reaction mixture was concentrated under vacuum. The residue was concentrated from toluene. The resultant gummy solid was treated with methanol (20 mL). Diethyl ether was added to the resultant slurry which was filtered to provide the title compound as white solid. lH NMR (400 MHz, CDCI3) δ 8.99 (br s, 2H), 5.54 (br m, IH), 4.12 (m, IH), 4.10 (s, 3H), 3.81 (m, IH),

3.39 (m, IH), 3.21 (d, 7 = 12.6 Hz, IH), 1.44 (d, 7 = 6.4 Hz, 3H), 1.23 (t, 7 = 7.3 Hz, 3H). ES MS M+l =

335

Step 10: (6S)-8-Ethyl-10-methoxy-N,6-dimethyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide To a solution of (6S)-8-ethyl-10-methoxy-6-methyl-l,9-dioxo-l,2,6,7,8,9- hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carbohydrazide (0.39 g, 1.2 mmol) and methylamine (5.9 mL, 11.8 mmol; 2 M in THF) in anhydrous dichloromethane (25 mL) in a water bath at room temperature, a solution of iodine (0.60 g, 2.4 mmol) in dichloromethane was added dropwise.

After the addition was completed, an aqueous solution of sodium sulfite was added and the mixture was stirred vigorously for 10 minutes. The organic phase was separated, diluted with chloroform, and washed with brine. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was triturated with a mixture of ethanol (7 mL) and diethyl ether (25 mL). The white solid precipitated was obtained by filtration and dried from its solution in toluene under vacuum. 1H NMR (400 MHz, CDCI3) δ 11.57 (s, IH), 7.38 (m, IH), 5.95 (br m, IH), 4.17 (s, 3H), 4.03 (dd, 7 =

13.4, 3.8 Hz, 1 H), 3.76 (heptet, 7 = 7.1 Hz, 1 H), 3.50 (heptet, 7 = 7.1 Hz, 1 H), 2.99 (dd, 7 = 12.9, 1.0 Hz, 1 H), 3.03 (d, 7 = 5.0 Hz, 3H), 1.44 (d, 7 = 6.6 Hz, 3H), 1.23 (t, 7 = 7.2 Hz, 3H). ES MS M+l = 334 Step 11: (6S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-methoxy-N,6-dimethyl-l,9-dioxo- l,2,6,7,8,9-hexahydropyrazino[r,2': l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide To a cold (0 °C) solution of (6S)-8-ethyl-10-methoxy-N,6-dimethyl-l,9-dioxo- l,2,6,7,8,9-hexahydropyrazino[l',2': l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (1.58 g, 4.73 mmol) in anhydrous DMF (50 mL), a solution of lithium bis(trimethylsilyl)amide (4.97 mL, 4.97 mmol, 1 M in THF) was added. After stirring at the same temperature for 25 minutes, 3-chloro-4-fluorobenzyl bromide (1.27 g, 5.68 mmol) was added. The reaction mixture was stirred at room temperature for 10 minutes and concentrated under vacuum. The residue was partitioned between chloroform and brine. The organic extract was dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. The residue was subjected to column chromatography on silica gel eluting with a 1-5% methanol in ethyl acetate gradient. Collection and concentration of appropriate fractions provided the title compound. lH NMR (400 MHz, CDCI3) δ 7.46 (dd, 7 = 6.9, 2.2 Hz, IH), 7.32 (m, IH), 7.09 (t, 7 = 7.6 Hz, IH), 7.03

(br signal, IH), 5.92 (m, IH), 5.32 (d, 7 = 14.1 Hz, IH), 5.26 (d, 7= 14.1 Hz, IH), 4.14 (s, 3H), 3.97 (dd, 7 = 13.2, 3.7 Hz, IH), 3.73 (heptet, 7 = 7.2 Hz, 1 H), 3.51 (heptet, 7 = 7.1 Hz, IH), 3.21 (dd, 7= 13.2, 1.7 Hz, IH), 3.03 (d, 7 = 5.0 Hz, 3H), 1.42 (d, 7 = 6.6 Hz, 3H), 1.23 (t, 7 = 7.1 Hz, 3H). ES MS M+l = 476

Step 12:

(6S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-l,9-dioxo- l,2,6,7,8,9-hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d3pyridazine-4-carboxamide

To a solution of (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-methoxy-N,6-dimethyl-l,9- dioxo-l,2,6,7,8,9-hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (1.15 g, 2.41 mmol) in anhydrous dichloromethane (800 mL), a solution of boron tribromide in dichloromethane (3.14 mL, 3.14 mmol; 1 M) was added. After stirring at room temperature for 5 minutes, the reaction mixture was treated with anhydrous methanol, stirred for 30 minutes, and concentrated under vacuum. The procedure was repeated twice. The residue was dissolved in a mixture of methanol and acetonitrile and treated with aqueous sodium hydroxide. The mixture was subjected to purification on preparative reverse phase high pressure column chromatography. Collection and lyophilization of appropriate fractions provided the title compound as white amorphous solid.

MK 2048

lH NMR (400 MHz, CDCI3) δ 7.48 (dd, 7 = 7.0, 2.2 Hz, IH), 7.33 (m, IH), 7.09 (t, 7 = 8.7 Hz, IH), 6.01 (m, IH), 5.33 (d, 7= 14.1 Hz, IH), 5.27 (d, 7 = 14.1 Hz, IH), 3.99 (dd, 7= 12.8, 4.0 Hz, 1 H), 3.71(heptet, 7 = 7.1 Hz, 1 H), 3.49 (heptet, 7 = 7.1 Hz, 1 H), 3.24 (dd, 7 = 13.2, 1.5 Hz, 1 H), 3.03 (d, 7 = 5.1 Hz, 3H), 1.42 (d, 7 = 6.6 Hz, 3H), 1.24 (t, 7 = 7.3 Hz, 3H). ES MS M+l = 462

The amorphous product was dissolved in boiling methanol (1.4 g/200 mL). Upon cooling in an ice-water bath, a precipitate formed which was separated by obtained by filtration to afford a white crystalline solid.

MK 2048sodium salt

The corresponding sodium salt was prepared by treatment of a solution of (6S)-2-(3- chloro-4-fluorobenzyl)-8-ethyl- 10-hydroxy-N,6-dimethyl-l ,9-dioxo- 1 ,2,6,7,8,9- hexahydropyrazino[r,2':l,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (920 mg, 1.99 mmol) in aqueous acetonitrile with aqueous sodium hydroxide (1.03 equivalent), followed by lyophilization of the resultant solution.

(5S)-1-ethyl-5-methylpiperazin-2-one

 1,5-Cyclooctadiene-iridium(I) chloride dimer, Chloro(1,5-cyclooctadiene)iridium(I) dimer, Di-μ-chlorobis[(1,2,5,6-η)-1,5-cyclooctadiene]diiridium, Iridium(I) chloride 1,5-cyclooctadiene complex dimer, [Ir(1,5-cod)Cl]2, [Ir(1,5-cod)Cl]₂, [Ir(cod)Cl]2

(S)-1-[(R)-2-Di-(4-methoxy-3,5-dimethylphenyl-phosphino)ferrocenyl]-ethyl-dicyclohexylphosphine

SL-J006-2

(5S)-l-Ethyl-5-methylpiperazin-2-one was alternatively prepared as follows:

Step 1: N^rf-Butoxycarbonyl-N^ethylglycinamide Ethylamine (37 g, 0.82 mol) was condensed into a pressure vessel at 0 °C. N-(tert- butoxycarbonyl)glycine methyl ester (50 mL, 0.34 mol) was added. The vessel was sealed and the mixture was stirred at room temperature overnight. The product mixture was concentrated under vacuum and the residue was passed through a pad of silica gel eluting with ethyl acetate. The solution was concentrated under vacuum to provide the title compound as a clear oil. lH NMR (400 MHz, CDCI3) δ 6.11 (br s, IH), 5.18 (br s, IH), 3.77 (d, 7 = 5.7 Hz, 2H), 3.31 (q, 7 = 7.1

Hz, 2H), 1.15 (t, 7 = 7.1 Hz, 3H).

Step 2: l-Ethyl-5-methylpyrazin-2(lH)-one A cold (0 °C) solution of N^tø^butoxycarbonyl-N^ethylglycinamide (68.0 g, 0.33 mol) in anhydrous dichloromethane (500 mL) was saturated with anhydrous hydrogen chloride gas. After stirring at the same temperature for 1.5 hours, the solution was recharged with more hydrogen chloride gas and stirred for additional 15 minutes. The reaction mixture was concentrated under vacuum. The residue was dissolved in methanol, diluted with toluene, and concentrated under vacuum to afford the intermediate N-ethylglycinamide HCI salt.

This was stored under vacuum overnight and used without further purification. A solution of N-ethylglycinamide HCI salt (44.2 g, 0.32 mol), aqueous sodium hydroxide (640 mL, 1M), water (350 mL), pyruvic aldehyde (20.9 mL, 40% solution in water) was heated in an oil bath at 120 °C for one hour. The reaction mixture was cooled and saturated with solid sodium chloride. The mixture was extracted with chloroform (4×250 mL).

The combined organic extract was dried over anhydrous sodium sulfate, filtered, and passed through a plug of silica gel. The silica gel was rinsed successively with ethyl acetate and then 2% methanol in ethyl acetate. The eluted fractions were combined and concentrated under vacuum. The residual solid was recrystallized from diethyl ether to afford the title compound as pale yellow solid. lH NMR (400 MHz, CDCI3) δ 8.11 (s, IH), 6.92 (s, IH), 3.92 (q, 7 = 7.2 Hz, 2H), 2.28 (s, 3H), 1.37 (t, 7 = 7.2 Hz, 3H).

Step 3: (5 S)- 1 -Ethyl-5-methylpiperazin-2-one

A mixture of chloro-l,5-cyclooctadiene iridium (I) dimer (34 mg, 51 μmol) and (S)-l-[(R)-2-di-(3,5-bis(trifluoromethyl)phenyl)phosphino)ferrocenyl]ethyldicyclohexylphosphine (44 mg, 51 μmol; Solvias AG, SL-J006-2) in a mixture of 1:2 toluene and methanol (100 mL; purged with nitrogen for 15 minutes) was sonicated under an atmosphere of nitrogen for 15 minutes. To the resultant mixture, iodine (0.39 g, 1.52 mmol) and l-ethyl-5-methylpyrazin-2(lH)-one (7.0 g, 50.66 mmol) was added. The resultant mixture was heated in an oil bath at 50 °C under an atmosphere of hydrogen gas at 800 psi for 48 hours. The product mixture was filtered through a pad of Celite. The filtrate was concentrated under vacuum. The residue was treated with chloroform saturated with ammonia gas (100 mL). The resultant suspension was filtered through a pad of Celite, which was the rinsed with chloroform saturated with ammonia gas. The combined filtrate was concentrated under vacuum. The residue was concentrated as a solution in toluene for subsequent reaction. lH NMR (400 MHz, CDCI3) δ 3.58 (d, 7 = 17.2 Hz, IH), 3.53(d, 7 = 17.2 Hz, IH), 3.49-3.35 (m, 2H),

1.19 (d, 7 = 5.9 Hz, 3H), 1.14 (t, 7 = 7.2 Hz, 3H).

……………..

US 7538112

http://www.google.com/patents/US7538112

Step 12: (6S)-2-(3-Chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1′,2′:1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide

To a solution of (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-methoxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1′,2′:1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (1.15 g, 2.41 mmol) in anhydrous dichloromethane (800 mL), a solution of boron tribromide in dichloromethane (3.14 mL, 3.14 mmol; 1 M) was added. After stirring at room temperature for 5 minutes, the reaction mixture was treated with anhydrous methanol, stirred for 30 minutes, and concentrated under vacuum. The procedure was repeated twice. The residue was dissolved in a mixture of methanol and acetonitrile and treated with aqueous sodium hydroxide. The mixture was subjected to purification on preparative reverse phase high pressure column chromatography. Collection and lyophilization of appropriate fractions provided the title compound as white amorphous solid.

¹H NMR (400 MHz, CDCl₃) δ 7.48 (dd, J=7.0, 2.2 Hz, 1H), 7.33 (m, 1H), 7.09 (t, J=8.7 Hz, 1H), 6.01 (m, 1H), 5.33 (d, J=14.1 Hz, 1H), 5.27 (d, J=14.1 Hz, 1H), 3.99 (dd, J=12.8, 4.0 Hz, 1 H), 3.71 (heptet, J=7.1 Hz, 1 H), 3.49 (heptet, J=7.1 Hz, 1 H), 3.24 (dd, J=13.2, 1.5 Hz, 1 H), 3.03 (d, J=5.1 Hz, 3H), 1.42 (d, J=6.6 Hz, 3H), 1.24 (t, J=7.3 Hz, 3H). ES MS M+1=462

The amorphous product was dissolved in boiling methanol (1.4 g/200 mL). Upon cooling in an ice-water bath, a precipitate formed which was separated by obtained by filtration to afford a white crystalline solid.

The corresponding sodium salt was prepared by treatment of a solution of (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1′,2′:1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide (920 mg, 1.99 mmol) in aqueous acetonitrile with aqueous sodium hydroxide (1.03 equivalent), followed by lyophilization of the resultant solution.

References

Sequence Type: DNA fragment
	CTGAGTCTGTTTTCCATTCT

ATL 1102

The antisense oligonucleotide is complementary to a region in the 3′UTR of human ITGA4 (integrin alpha 4) cDNA whose sequence is 5′-CTGAGTCTGTTTTCCATTCT-3′
Phosphorothioate antisense oligonucleotide consisting of a 9-nucleotide central region of deoxynucleotides flanked by 3 2′-O-methoxyethyl (2′-MOE) nucleotides on the 5′ end and 8 2′-MOE nucleotides on the 3′ end.

TOORAK, Australia, April 1, 2014 /PRNewswire/ — Antisense Therapeutics Limited (“ANP” or the “Company”) is pleased to advise that results from a chronic toxicity study in monkeys indicate that ATL1102, an antisense oligonucleotide currently under development for the treatment of multiple sclerosis (MS), was well-tolerated when given subcutaneously for a 6-month dosing period at the 2 dose levels tested (1.5 and 3mg/kg/dose). The Company believes that the preclinical and clinical experience to date with ATL1102 should allow dosing in future trials at or above the 1.5 mg/kg/dose level.

read at

http://www.sys-con.com/node/3037721

ATL-1102
ISIS-107248
TV-1102

ITGA4 Expression Inhibitors

Signal Transduction Modulators

PHASE 2

Antisense Therapeutics
Isis Pharmaceuticals

Antisense Therapeutics Limited (ASX: ANP) is an Australian publicly listed biopharmaceutical drug discovery and development company. Its mission is to create, develop and commercialise second generation antisense pharmaceuticals for large unmet markets. ANP has 4 products in its development pipeline that it has in-licensed from Isis Pharmaceuticals Inc., world leaders in antisense drug development and commercialisation – ATL1102 (injection) which has successfully completed a Phase II efficacy and safety trial, significantly reducing the number of brain lesions in patients with multiple sclerosis, ATL1103 a second-generation antisense drug designed to block GHr production and thereby lower blood IGF-I levels and is in clinical development as a potential treatment for growth and other GH-IGF-I disorders, ATL1102 (inhaled) which is at the pre-clinical research stage as a potential treatment for asthma and ATL1101 a second-generation antisense drug at the pre-clinical stage being investigated as a potential treatment for cancer.

ATL1102 is a second generation antisense inhibitor of CD49d, a subunit of VLA-4 (Very Late Antigen-4). In inflammation, white blood cells (leukocytes) move out of the bloodstream into the inflamed tissue, for example, the Central Nervous System (CNS) in MS, and the lung airways in asthma. The inhibition of VLA-4 may prevent white blood cells from entering sites of inflammation, thereby slowing progression of the disease. VLA-4 is a clinically validated target in the treatment of MS. Antisense inhibition of VLA-4 has demonstrated positive effects in a number of animal models of inflammatory disease including MS with the MS animal data having been published in a peer reviewed scientific journal. ATL1102 was previously shown by Antisense Therapeutics to be highly effective in reducing MS lesions in a Phase IIa clinical trial in MS patients.

ATL-1102 is an antisense oligonucleotide in phase II clinical trials at Isis Pharmaceuticals and Antisense Therapeutics for the treatment of relapsing-remitting multiple sclerosis (MS) in a subcutaneous injection formulation. Phase I clinical trials in a subcutaneous injections for stem cell mobilization and preclinical studies of an inhalation formulation of the drug candidate for the treatment of asthma are also being conducted at Antisense Therapeutics.

ATL-1102 is complementary to nt 4288-4207 (3′UTR) of human integrin alpha 4 (ITGA4) cDNA, and thus inhibits ITGA4 expression, blocking the synthesis of CD49d, a subunit of very late antigen-4 (VLA-4). VLA-4 is known to play a part in both the onset and progression of MS, and its inhibition may prevent white blood cells from entering the central nervous system.

ATL-1102 was originally developed at Isis Pharmaceuticals. In December 2001, Isis and Circadian Technologies formed Antisense Therapeutics, established to focus on the discovery and development of antisense therapeutics. As part of the company’s formation, Antisense Therapeutics received a license to ATL-1102 and entered into a five-year antisense drug discovery and development program with Isis. In 2008, Antisense licensed ATL-1102 to Teva. In 2010, Teva terminated its licensee agreement with Antisense for the development of ATL-1102 for the treatment of relapsing-remitting multiple sclerosis. The company stated that the compound was not on line with its preferred product pipeline. In 2001, ATL-1102 was licensed to Antisense Therapeutics by Isis Pharmaceuticals. In 2012, development and commercialization rights to the product were licensed to Tianjin International Joint Academy of Biotechnology and

Contact Information:
Website: www.antisense.com.au
Managing Director: Mark Diamond +61 (3) 9827 8999
USA Investor/Media: Joshua Drumm +(1) 212 375 2664;jdrumm@tiberend.com
Australia Investor/Media: Simon Watkin +61 (0)413 153 272;simon@marketconnect.com.au

SOURCE Antisense Therapeutics Limited

MG 96077

poster

MG96077 - MethylGene

………..http://methylgene.solocom.biz/files/2011/10/poster102.pdf     ……………..lot of data presented

Mirati Therapeutics (USA)

Pre-Clinical for Gram-negative bacteria

Beta-Lactamase Inhibitors—Non-beta-Lactam Phosphonate-Based

Mirati Therapeutics is seeking partners to continue the development of the compound MG96077, a non-beta-lactam phosphonate-based beta-lactamase inhibitor that has shown an inhibitory profile for both class A and class C beta-lactamase enzymes [1,2].

Potent, irreversible inhibitor of serine β-lactamases that efficiently protects βlactams from hydrolysis in a variety of class
A- and class C-producing organisms-

September 14, 2009 13:23 ET

MethylGene Presents Preclinical Data for Its Beta-Lactamase Inhibitor, MG96077, at the 49th Annual ICAAC Meeting

MONTREAL, QUEBEC–(Marketwire – Sept. 14, 2009) – MethylGene Inc. (TSX:MYG) today disclosed preclinical data for MG96077, a novel, broad spectrum, non-beta-lactam beta-lactamase inhibitor (BLI). MG96077 possesses a broad-spectrum inhibitory profile for both class A and class C beta-lactamase enzymes, including extended spectrum beta-lactamases (ESBLs). In addition, the compound overcomes resistance in beta-lactam-resistant organisms such as Pseudomonas aeruginosa. The data were presented in a poster session at the 49th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Annual Meeting in San Francisco, California.

Poster C1-1373: Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against Beta-Lactam-Resistant P. aeruginosa and K. pneumoniae

MG96077 was tested in combination with imipenem, a commonly-used antibiotic agent for a variety of serious infections.

A series of in vitro and in vivo preclinical studies focused on comparing the combination of MG96077 and imipenem to imipenem alone, or imipenem plus currently approved BLIs, were performed. Greater than 90 percent of imipenem-resistant clinical isolates of Pseudomonas aeruginosa and Klebsiella pneumoniae were rendered susceptible with the addition of MG96077 to imipenem. The combination of imipenem and any of the three currently approved BLIs did not achieve greater than 61 percent coverage.

Furthermore, the combination of imipenem and MG96077 in vivo demonstrated 3-6 log reduction in colony forming units (CFU) and a 100 percent survival rate in combating imipenem-resistant P. aeruginosa infections of mouse spleen and lung. The pharmacokinetic properties of MG96077 were similar to imipenem in preclinical studies with no observable drug-drug interactions.

Thus, MG96077 is a novel beta-lactamase inhibitor that restores efficacy to imipenem against a high percentage of imipenem-resistant Pseudomonas and Klebsiella strains and, therefore, may address the clinical need for antibacterial therapies with more potent coverage of resistant gram-negative organisms.

MethylGene retains exclusive rights to MG96077 and a series of related molecules. Additional data has been developed regarding MG96077 compared to other beta-lactam antibiotics, as well as other compounds in the series paired with various beta-lactam antibiotics.

“Antibiotic resistance rates are increasing among several problematic gram-negative pathogens, including P. aeruginosa, K. pneumoniae, Acinetobacter spp. and Enterobacteriaceae that are often responsible for serious hospital-acquired infections. In these studies, MG96077 appears to demonstrate activity in a variety of organisms and we look forward to further evaluation of this compound in what is a growing antibiotic market in need of novel treatments,” said Donald F. Corcoran, President and Chief Executive Officer of MethylGene.

About MethylGene

MethylGene Inc. (TSX:MYG) is a publicly-traded, clinical stage, biopharmaceutical company focused on the discovery, development and commercialization of novel therapeutics with a focus on cancer. The Company’s product candidates include: MGCD265, an oral, multi-targeted kinase inhibitor targeting the c-Met, VEGF, Ron and Tie-2 receptor tyrosine kinases that is in Phase I and Phase II clinical trials for cancers; MGCD290, a fungal Hos2 inhibitor being developed for use in combination with fluconazole for serious fungal infections that is in Phase I clinical studies; and MGCD0103, an oral, isoform-selective HDAC inhibitor which has been in multiple clinical trials for solid tumors and hematological malignancies and is licensed to Taiho Pharmaceutical Co. Ltd. A fourth compound discovered using MethylGene’s HDAC platform, EVP-0334 – a potential cognition enhancing agent, is in a Phase I study sponsored by EnVivo Pharmaceuticals Inc. MethylGene also has a funded collaboration with Otsuka Pharmaceutical Co. Ltd. for applications in ocular diseases using the Company’s proprietary kinase inhibitor chemistry. Please visit our website at www.methylgene.com.

1. Martell, L.A.; Rahil, G.; Vaisburg, A.; Young, K.; Hickey, E.; Hermes, J.; Dininno, F.; Besterman, J.M. A Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against β-Lactam-Resistant P. aeruginosa and K. pneumoniae. In Proceedings of 49th ICAAC Annual Meeting, San Francisco, CA, USA, 14 September 2009.
2. Mirati Therapeutics. MG96077. Available online: http://mirati.com/other-pipeline-assets/mg96077(accessed on 9 July 2013).
3. 49th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) Annual Meeting in San Francisco, California.
   Poster C1-1373: Novel Beta-Lactamase Inhibitor Potentiates and Extends the Antibacterial Activity of Imipenem against Beta-Lactam-Resistant P. aeruginosa and K. pneumoniae